Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Recombinant Rabbit CXCL12 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant fibroblast growth factor 2 (FGF2, 20 ng/mL, Life Technologies), and beta-mercaptoethanol (0.1% ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... Chromatin antibody complexes were isolated using protein A-beads for rabbit primary antibodies or G-beads for mouse primary antibodies (Dynabeads, Invitrogen). The PCRs with 1:20 dilutions of genomic DNA (input ...
-
bioRxiv - Genetics 2020Quote: ... 10 cycles). Immunoprecipitation was performed using polyclonal rabbit anti-Mcd1p (a gift from V. Guacci) antibodies and protein A Dynabeads (Invitrogen).
-
bioRxiv - Cell Biology 2021Quote: ... Each protein of interest was then detected with HRP-conjugated goat anti-rabbit or anti-mouse IgG antibody (1:2000; Invitrogen), and visualized using SuperSignal West Pico PLUS Chemiluminescent Substrate or SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: Immunohistochemistry was performed using monoclonal antibodies directed to MV N protein (clone 83KKII, Chemicon [57]) or rabbit polyclonal antibody directed to GFP (Invitrogen). Goat anti-mouse IgG1 or goat anti-rabbit antibody conjugated with biotin was included as secondary antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mg of pre-cleared HeLa nuclear extracts were incubated overnight at 4°C with either 40 μg ATRX antibody or rabbit IgG cross-linked to Dynabeads Protein G (Invitrogen). Beads were washed three times with 5 ml wash buffer (20 mM HEPES ...
-
bioRxiv - Molecular Biology 2021Quote: ... For Protein A-tagged strains, immunoprecipitation was carried out with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) as described 57 ...
-
bioRxiv - Genomics 2021Quote: ... A specific antibody or a total rabbit IgG control was added to the lysate along with Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... Trypsin gene expression levels were quantified by Q-PCR and trypsin protein was analyzed by Western Blot using rabbit polyclonal trypsin antibody (ThermoFisher).
-
bioRxiv - Developmental Biology 2022Quote: ... A specific antibody or a total rabbit IgG control was added to the lysate along with Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... The horseradish peroxidase (HRP)-conjugated Protein A or HRP-conjugated rabbit anti-mouse secondary antibody for immunoblotting were from Invitrogen. The alpha smooth muscle actin (# ab7817) ...
-
bioRxiv - Immunology 2023Quote: ... The low and high molecular weight membranes proteins were incubated with respective primary antibodies (Rabbit anti-human BAIAP2L1, PA5-54000, Invitrogen) or (Goat anti-mouse GAPDH ...
-
bioRxiv - Microbiology 2023Quote: ... the membranes were incubated with an anti-TasA antibody (rabbit) at a 1:20,000 dilution in Pierce Protein-Free (TBS) blocking buffer (Thermo Fisher). A secondary anti-rabbit IgG antibody conjugated to horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... This was followed by overnight incubation with conjugated anti-green fluorescent protein (anti-GFP) rabbit antibody (1:2000; catalog no. A21311; Invitrogen). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... and rabbit anti-H1.8 custom antibodies (26) (Identification# RU2130) were conjugated to Protein-A coupled Dynabeads (Thermo Fisher Scientific, # 10001D) at 250 μg/ml beads at 4 °C for overnight on a rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purifications were carried out from 150 μl of the whole-cell extract (2 mg protein) per experiment using 37 µl of Dynabeads M-280 sheep anti-rabbit IgG (Invitrogen) and 2 µl of the anti-LytA antibody (Biomedal) ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... rabbit (goat anti-rabbit IgG, Invitrogen), sheep (rabbit anti-sheep IgG ...
-
bioRxiv - Immunology 2024Quote: ... Cell proteins and EVs proteins were quantified by Qubit Protein Assay (Invitrogen) using a Qubit 3.0 Fluorometer (Thermo Fisher ...
-
bioRxiv - Biochemistry 2019Quote: Polyclonal antibody against recombinant EhTopo II fragment was commercially raised in rabbits (Abgenex, India) and purified from the crude sera using Protein-A sepharose (Invitrogen, USA) affinity chromatography ...