Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Biochemistry 2020Quote: ... TFA and 1 μL of this dilution and 1μL of the undiluted peptides from bands 3 and 4 were injected onto the trapping column (Thermo Scientific, PepMap100, C18, 300 μm × 5 mm), using a partial loop injection ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and incubated overnight at 4°C with primary antibody solution: Antibody in IF buffer containing 3% Saponin (Fisher Scientific, Cat. No. 55-825-5100GM). Antibodies used were as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... SSEA-4 (ThermoFisher), Sox2 (Epitomics ...
-
bioRxiv - Physiology 2021Quote: ... fluo-4 (Invitrogen). Ca2+ and Lifeact images were acquired at 1 image/10 seconds.
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (ThermoFisher), 1% Sodium Pyruvate (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 4 % FCS (Gibco), 200 units/mL penicillin and 0.2 mg/ mL streptomycin ...
-
bioRxiv - Genomics 2021Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4% B27-(ThermoFisher), 100 µM Palmitate (Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... SP-DiOC18(3) (ThermoFisher Scientific) for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: sucrose (Fisher Scientific #S5-3), cellobiose [D-(+)-cellobiose ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM NaOH (Fisher Scientific) in neurobasal medium] and centrifugation at 800 × g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuantStudio 3 system (Thermofisher) was used for reactions under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... and 3 μl RNAiMAX (Invitrogen). For every gene ...
-
bioRxiv - Microbiology 2020Quote: ... using a QuantStudio 3 (ThermoFisher). KiCqStart SYBR green primers for qRT-PCR (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 3) Accutase (Thermo Fisher Scientific) treatment for 15 min (Figure 4E) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-galectin 3 (ThermoFisher). Membranes were imaged using LI-COR Odyssey IR imager ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3% sodium bicarbonate (Gibco). A549 (ATCC CCL-185 ...
-
bioRxiv - Cancer Biology 2021Quote: ... YOYO-3 (Thermo Fisher Scientific) was supplemented to the culture to detect cellular death ...