Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Phospho p95 NBS1 S343 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Cell Biology 2020Quote: ... PRC1 (mouse mAb IgG2b, clone 16F2, product MA1-846; used at 1/100) was from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary Strep-MAb classic chromeo-488 (IBA) and secondary Alexa-fluor 488 goat anti-mouse (Invitrogen) were applied sequentially with PBS washes in between ...
-
bioRxiv - Immunology 2021Quote: ... Serial dilutions of the mAb samples were made in 1X minimal essential medium (MEM; Life Technologies) starting at 30 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ul of mAb DG52 pre-coupled to 100 μl Dynabeads™ Protein G (Thermo Fisher) was added to the supernatant and incubated for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... Chambers were washed 3X with MAB and incubated with anti-mouse Alexa647 (A21236, Thermo Fisher Scientific) secondary antibody for 1.5 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse mAb against cathepsin L (BMS1032) and α-tubulin (T5158) were bought from Thermo Fisher Scientific and Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Goat anti-rat and streptavidin Molecular Probes Alexa-Fluor-488 and 633 conjugated secondary mAbs (Invitrogen) were used at 2µg/ml and all sections were counterstained with DAPI to distinguish cell nuclei ...
-
bioRxiv - Immunology 2021Quote: The IgGs representing the mAbs were produced in either HEK 293T (ATCC) or Expi293 (Thermo Scientific) cells ...
-
bioRxiv - Microbiology 2021Quote: ... monoclonal anti-HAtag antibody (1:8000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) or COVID-19 patient serum (1:200) ...
-
bioRxiv - Immunology 2021Quote: ... The IC50 of the evaluated mAbs was tested by the Varioskan LUX Microplate Spectrophotometer (Thermo Fisher), and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.
-
bioRxiv - Cell Biology 2022Quote: ... The rat PE-conjugated mAb against F4/80 (catalog #12-4801-82) was from Thermo Fisher. The rabbit polyclonal anti-mouse αM antibody (catalog #ab128797 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by an incubation with mouse anti-human E-cad cytoplasmic domain mAb (4A2C7, Life Technologies). In some experiments ...
-
bioRxiv - Immunology 2023Quote: ... Myc mAb (D84C12) was labeled by Alexa Fluor™ 647 Antibody Labeling Kit (Invitrogen, Cat# A20186). Surfaced staining was conducted using Cell Staining Buffer (Biolegend ...
-
bioRxiv - Immunology 2024Quote: ... mAbs were expressed by transient transfection in Expi293F cells in FreeStyle F17 expression media (Thermo Fisher) (0.1% Pluronic Acid F-68 and 20% 4 mM L-glutamine ...
-
bioRxiv - Immunology 2024Quote: ... AnnexinV/7ADD (eBiosciences) and Fas Ligand Ms Anti-Hu mAb-FITC (SB93a, 1:200, Life Technologies). For the characterization of primary macrophages ...
-
bioRxiv - Bioengineering 2024Quote: ... Tregs were stained with conjugated mAb targeting the intracellular Helios (eBiosciences, Life technologies corp., Carlsbad, CA) and FoxP3 proteins (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... Anti-flavivirus E protein mAb 4G2 was conjugated to Alexa Fluor 488 5-SDP (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Primary antibodies used were: anti-KCC2 phospho-Ser940 (Thermo Fisher Scientific, cat #PA5-95678), anti-(neuronal)-β-Tubulin III (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 1% BSA (Thermo Scientific, cat# 37520, for phospho-Src family) or 3% milk (Lab Scientific ...
-
bioRxiv - Genomics 2020Quote: ... and phosphorylated eIF2α was detected using Phospho-eIF2a (Ser52) Polyclonal Antibody (Invitrogen #44-728G). Membranes were then washed and probed with secondary antibody anti-rabbit IgG ...
-
bioRxiv - Cancer Biology 2022Quote: ... The anti-phospho-FAM129B Ab (S679/683; PA595683) was also purchased from Thermo Fisher. The anti-Erk (137F5) ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-Phospho-Tau (Ser202, Thr205) (AT8) (1:200; Thermo Fisher Scientific; #MN1020). Donkey derived secondary antibodies conjugated with Alexa Fluor-488 or −647 (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... Phospho protein was developed with Pierce ECL Plus Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... or antibody specific to Serine 396 of tau (Phospho-Tau S396, Thermo Fisher Scientific) with β-actin (ab8227 ...
-
bioRxiv - Immunology 2020Quote: ... Bead-conjugation was carried out at 4°C in Phospho-buffered saline (PBS, Gibco), for 1 hour with regular agitation ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-tubulin (1:2000; Chemicon), anti-phospho-Tau (Ser202, Thr205) (AT8) (1:500, Invitrogen), anti-pTauThr181 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... The primary antibodies (Phospho-FAK (Tyr397) Polyclonal Antibody (Thermo Fisher, 44-624G; 1:1000), Anti-GAPDH antibody Mouse monoclonal (Sigma #8795 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Phospho-TMT peptides were measured with a Fusion Lumos Tribrid mass spectrometer (Thermo Scientific) that was coupled to a Dionex UltiMate 3000 RSLCnano System (Thermo Scientific) ...