Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 7 Quinolinecarboxylicacid 1 2 3 4 tetrahydro 1 methyl 2 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Colonies were passaged every 4 – 7 days using 3 – 5min incubation with 0.5mM UltraPure EDTA (Invitrogen) as required.
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... After a clarifying spin for 15 min at 14,000 ×g and 4°C 2 μl (MICOS complex) or 7 μl (all other mitochondrial protein complexes) G-250 Sample Additive (Invitrogen, Waltham, Massachusetts, USA) containing 40% glycerol were added ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Bioengineering 2022Quote: RPTEC organoids were imaged every 2-3 days with a EVOS FL 2 Auto microscope (Thermo Fisher) with a 4x objective ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... 2°: goat anti-mouse AF488 (1:500) (Invitrogen, A-11001), and donkey anti-rabbit Cy5 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... and ethidium homodimer-1 (2 mM in DMSO, L3224, ThermoFisher) were added directly to the cell medium to a final concentration of 1 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... stained with Neurotrace for 2 hours (1:500, N21479; Invitrogen), rinsed twice with 2x SSCT and mounted on a slide with Fluoromount-G ...
-
bioRxiv - Microbiology 2019Quote: ... N-2 supplement (1:200; catalog number 17502-048; Invitrogen), 20 ng/ml fibroblast growth factor (catalog number 4114-TC-01M ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were loaded with 1 μM fura-2 AM (Invitrogen) for 40 min before the measurements at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-Cadherin (Invitrogen clone ECCD-2, 1:500), rabbit anti-PH3 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... 4,6-diamino-2-phenylindole (DAPI) dihydrochloride (1:10,000, Life Technologies) was used to counterstain the nucleus/chromosomes ...
-
bioRxiv - Genomics 2019Quote: ... 1 µl of 2 U/µl E Coli RNaseH (Invitrogen) and then incubating at 16°C for 2 hours ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1 U/µL alkaline phosphatase (Thermo Fisher) and 10 µL 10 x alkaline phosphatase buffer was added and incubated at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B-27 (Gibco) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 μM JC-1 dye (M34152, Thermo Fisher Scientific) at 37 °C in a 5% CO2 incubator for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and diamidino-2-phenylindole (DAPI) (1:500, Thermo Scientific, 62247).
-
bioRxiv - Microbiology 2021Quote: ... BMDMs were treated with 1 mM 2-DG (Life Technologies) dissolved in medium without glucose for 2h prior to infection ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 ng mL−1 bFGF (Cat. no. 233FB025CF, Fisher Scientific), and 10 μM all-trans retinoic acid (Cat ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:2 with PBS with Ca2+Mg2+ (Thermo Fisher) was added to the cells and incubated in the dark for 15 min before reading on a Synergy H1 Hybrid Multi-Mode plate reader (Biotek) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... 1% Penicillin-Streptomycin and 55 µM 2-Mercaptoethanol (all Gibco) supplemented with 4% FLT3L supernatant (generated from the cell line CHO flag Flk2.clone5 kindly provided by Prof Nic Nicola ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Immunology 2021Quote: ... lymphocytes were labeled with CellTracker dyes (Invitrogen, 1-2 μM). LF chips were fixed by filling the perfusion channel with 4% paraformaldehyde in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Bioengineering 2022Quote: ... diluted in Opti-HBSS (1:2 Opti-MEM (#11058021, Gibco)) and HBSS ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% antibiotic-antimycotic (ThermoFisher #1540062) ...
-
bioRxiv - Plant Biology 2022Quote: ... 1× phosphatase inhibitor cocktail 2 (Thermo Fisher Scientific, Waltham, MA), 1× phosphatase inhibitor cocktail 3 (MilliporeSigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% N2 supplement and 2% B27 with RA supplement (ThermoFisher) and were then fixed and analyzed by immunostaining.
-
bioRxiv - Neuroscience 2023Quote: ... 1 % N-2 supplement (100x, #17502048, Thermo Fisher Scientific, USA), 20 ng/mL recombinant human EGF (#PHG0313 ...
-
bioRxiv - Neuroscience 2022Quote: ... L-glutamine (2 mM) and Na+ pyruvate (1 mM) (Invitrogen). After attachment for 3–4 h ...