Labshake search
Citations for Thermo Fisher :
751 - 800 of 4311 citations for 6 METHYLPHTHALAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... on a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems) in 384-well plates ...
-
bioRxiv - Biophysics 2021Quote: ... blotted for 2-6 s in a VitroBot (Mark IV, ThermoFisher) at 4 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2020Quote: ... were seeded (four replicates) in 6-well cell culture plates (Nunc) at a density of 2 × 106 cells/well and incubated at 37°C in a CO2 incubator one day before transfection was performed with 50 nM (final concentration ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg plasmid and 6 µl Turbofect (Thermo Fisher Scientific, USA) were combined ...
-
bioRxiv - Microbiology 2020Quote: ... Gene expression was determined by qPCR (Applied Biosystems QuantStudio 6 Flex) with SYBR Green master mix using primers from Primerbank (22 ...
-
bioRxiv - Microbiology 2021Quote: ... and a QuantStudio 6 Flex Real-Time PCR machine (Applied Biosystems). Reactions were performed in a final volume of 10 μL including 1 μL undiluted cDNA sample and 500 nM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and brought to 6 ml with UltraPure water (ThermoFisher Scientific 10977015). 320 µl aliquots were stored at -80C ...
-
bioRxiv - Immunology 2020Quote: ... and a custom 6-plex Luminex ProcartaPlex assay (Thermo Fisher Scientific) designed to profile the expression of ...
-
bioRxiv - Developmental Biology 2020Quote: ... coated 6 well plates in media containing 80% DMEM/F12 (Gibco), 20% knockout serum replacement (Gibco) ...
-
bioRxiv - Genetics 2019Quote: ... and analyzed using the Quant Studio 6 Flex system (Applied Biosystems). The real-time PCR conditions is one hold at [95°C ...
-
bioRxiv - Immunology 2021Quote: ... and a QuantStudio 6 Flex real-time PCR system (Life Technologies) were used to perform real-time quantitative PCR ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA) staining solution and mounted with cover glass ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Cell Biology 2022Quote: Cells were plated in a 6-well plate (Thermo Fisher Scientific) one day before the transfection of the expression construct of mCherry-proliferating-cell nuclear antigen (PCNA ...
-
bioRxiv - Immunology 2022Quote: ... OPTI-MEM (6 ml) and Lipofectamine 2000 (100 μl; Life Technologies) were added to each flask plus packaging plasmids psPAX2 (20 μg ...
-
bioRxiv - Physiology 2022Quote: ... in an ABI QuantStudio 6 Flex Real-Time System (Life Technologies). Reactions were performed in technical triplicates using specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Microbiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) antifade reagent (Life Technologies, CA, USA) and sealed with nail polish.
-
bioRxiv - Synthetic Biology 2022Quote: ... EBs were fed with Essential-6 medium (Thermo Fisher Scientific A1516401) containing 2.5uM dorsomorphin (Tocris ...
-
bioRxiv - Pathology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Neuroscience 2022Quote: ... coated 6-well NUNC™ plates in StemFlex medium (Gibco, A3349401) exchanged every 48 hours ...
-
bioRxiv - Physiology 2023Quote: ... and a QuantStudio 6 Flex Real Time PCR system (Thermo Fisher) using RNA pol2 as an internal control ...
-
bioRxiv - Neuroscience 2022Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Applied Biosystems). qPCR results comparing the injected and uninjected hemispheres were analyzed using the ΔΔCT methods and normalized to Actb ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Protein-DNA complexes were resolved on 6% nondenaturing polyacrylamide gels (Invitrogen) in 0.25 × TBE buffer (100V for 1.5h) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and carried out on Quant Studio 6 Flex System (Applied Biosystems). Relative gene expression was calculated by the 2−ΔΔCT method ...
-
bioRxiv - Molecular Biology 2022Quote: ... the crude rAAV2/6 lysates were treated with DNase I (ThermoFisher) at 37°C for 30 min to eliminate contaminating ...
-
bioRxiv - Genomics 2022Quote: ... buffer at pH 6 and nuclease-free water (ThermoFisher Scientific, USA). The slide was put in a slide holder and completely dipped in hematoxylin for 8min ...
-
bioRxiv - Physiology 2022Quote: ... with the QuantStudio 6 Flex Real-Time PCR system (Thermo Scientific).
-
bioRxiv - Microbiology 2023Quote: ... Electrophoresis was performed using pre-run 6% TBE gels (Invitrogen, MA) at 100-volts in 0.5x TBE buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... at 37°C for 6 minutes at which point DMEM (Gibco) was added ...
-
bioRxiv - Systems Biology 2022Quote: Nunc cell-culture treated 6-well plates (ThermoFisher scientific, Roskilde, Denmark) were coated with 1% Matrigel (Discovery Labware ...
-
bioRxiv - Neuroscience 2023Quote: ... interleukin 6 soluble receptor (Thermo Fisher Scientific, Waltham, USA, Cat # BMS214) and interleukin 13 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... qPCRs were performed using QuantStudio 6 system (Thermo Fisher Scientific, USA) and cycling conditions included 95°C for 10 min and 40 cycles consisting of denaturalization at 95°C for 15 seconds and annealing-extension at 60°C for 1 min ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative PCR was conducted on QuantStudio 6 (Thermo Fisher Scientific, USA) with SYBR Green (4309155 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and run in triplicates using a QuantStudio 6 system (ThermoFisher Scientific). A complete list of primers used in RT-qPCR can be found in the Supplementary Table 2.
-
bioRxiv - Plant Biology 2023Quote: ... and VIT1 was analyzed by qRT-PCR (QuantStudio 6, Thermo Fisher) using TaqMan Real-Time PCR Assays (Thermo Fisher) ...
-
bioRxiv - Pathology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (10 ng/ml; Thermo Fisher Scientific, Waltham, MA, USA), IL-21 (50 ng/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Genetics 2023Quote: ... or 2.5mM MQAE ((N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (Thermo Fisher, E3101) diluted in 5% sucrose overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... a QuantStudio™ 6 Flex real-time PCR system (Applied Biosystems). Target transcript levels were normalized to those of the indicated reference genes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μl 20× 6-carboxyfluorescein (FAM)-labeled Assay Mix (Applied Biosystems), and 9 μl of cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pulsed with 10-6 M of EdU (ThermoFisher, C10640) in cell culture media for 2h prior to fixation.
-
bioRxiv - Immunology 2023Quote: ... The following cytokines were measured: IL-6 (Invitrogen, #88-7064-88), IL-10 (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 6 U MspI (Thermo Fisher, cat. no. ER0541, 10 U/µl) and 60 fg unmethylated lambda-DNA (Promega ...
-
bioRxiv - Immunology 2023Quote: ... All culture wells were supplemented with 6 mg/ml PI (Invitrogen) and were incubated at 37°C for 40 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Bone marrow was seeded at 1x10^6 in RPMI (Gibco,11875119)+10%FBS containing 20ng/mL of recombinant GM-CSF (PreproTech ...