Labshake search
Citations for Thermo Fisher :
751 - 800 of 6735 citations for 6 HYDROXY 7 METHYLPURINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a ViiA 7 Real-Time PCR system (Thermo Fisher Scientific) at 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min ...
-
bioRxiv - Molecular Biology 2023Quote: HCT116 cells (passage #7) were seeded into McCoy’s 5A Medium (ThermoFisher) supplemented with 10% heat-inactivated FBS and 1x Antibiotic-Antimycotic (ThermoFisher ...
-
bioRxiv - Biophysics 2022Quote: COS-7 cells were cultured in high-glucose DMEM (GIBCO, 21063029) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... in triplicates on ViiA 7 Real-Time PCR System (Applied Biosystems). Relative expression levels were determined using the comparative Ct method with normalization to 36B4 as internal control ...
-
bioRxiv - Cell Biology 2023Quote: ... Reactions were analysed with ViiA 7 Real-Time PCR System (Thermofisher) using the following cycle conditions ...
-
bioRxiv - Biophysics 2022Quote: COS-7 cells were cultured in high-glucose DMEM (GIBCO, 21063029) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The relative fold change in gene expression was determined using the 2-ΔΔCt method ...
-
bioRxiv - Genomics 2023Quote: ... cells were resuspended at 1 × 10^7 in 90% FBS (ThermoFisher) 10% DMSO (Sigma Aldrich) ...
-
bioRxiv - Genetics 2023Quote: ... using 7 kDa molecular weight cutoff Zeba desalting columns (ThermoFisher Scientific). AAV was concentrated using Amicon Ultra-2 100 kDa MWCO ultrafiltration devices (Millipore Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a ViiA 7 Real-Time PCR system (AB Applied Biosystems) utilizing specific primers at a concentration of 1 µM ...
-
bioRxiv - Immunology 2023Quote: ... Buffy coats were diluted 1:7 with Dulbecco’s PBS (Life Technologies). PBMC were obtained by density gradient centrifugation at 2000 rpm for 20 min at room temperature with 35 mL cell suspension stacked on 15 mL Biocoll separation solution (Biochrom) ...
-
bioRxiv - Neuroscience 2023Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) qPCR primers are listed in Table S3.
-
bioRxiv - Genomics 2023Quote: ... Pelleted nuclei were resuspended in 400uL 2μM 7-AAD (Invitrogen, A1310) in Sort Buffer (1mM EDTA ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The reverse-transcription was conducted at a temperature of 45 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed in an ABI ViiATM 7 System (Applied Biosystems) with SYBR Green Master Mix (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... to evaluate the fraction of cytokeratin-7 (Thermo Scientific, MA5-11986), pan-vimentin (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... in triplicates on ViiA 7 Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated using the comparative Ct method with normalization to 36B4 as internal control ...
-
bioRxiv - Cell Biology 2023Quote: ... Zeba spin column 7 kDa cut-off (Thermo Fisher, Ref. 89882), 4-15% Stain-Free™ pre- casted polyacrylamide gels (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... on an ABI QuantStudio 7 Real-Time PCR machine (Applied Biosystems). A custom TaqMan probe for the skipped Dmd product (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... or LipofectamineTM 2000 (Thermo Fisher, COS-7 and SH-SY5Y cells). Imaging was performed 24 h after transfection ...
-
bioRxiv - Pathology 2024Quote: ... on a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the Quantstudio 7 Flex real-time PCR system (Applied Biosystems). Fold change in mRNA levels was calculated using the delta-delta comparative threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were run on a QuantStudio 7 Flex system (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1µg of extracted RNA from passage 7 was DNase (Thermo scientific) treated and converted to cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... The viability of cells was verified using 7-AAD (Life Technologies). Samples were acquired with a LSR II (BD Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... this buffer was supplemented with 7 M of urea (Fisher Scientific). After sonication ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alleles were called using Peak Scanner 2.0 (Applied Biosystems; see (7)) ...
-
bioRxiv - Microbiology 2023Quote: ... on a QuantStudio 12K Flex or a ViiA 7 (ThermoFisher Scientific). Primers (Eurofins ...
-
bioRxiv - Biochemistry 2023Quote: ... AMC (7-amino-4-methylcoumarin) fluorescence reference standard (ThermoFisher Scientific, A191): Prepare a 100 mM stock in DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by 7 days of selection with Blasticidin S HCl (Gibco).
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... AlexaFluor 568 goat anti mouse (Invitrogen, A11004, 7 RRID:AB_2534072, 1:2000), AlexaFluor 568 anti rabbit (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and CellTracker Blue (4-chloromethyl- 6.8- difluoro- 7- hydroxycoumarin; CMF2HC; Invitrogen), respectively ...
-
bioRxiv - Cell Biology 2024Quote: Real-time search (RTS)7 was executed in XCalibur (ThermoFisher Scientific). RTS was performed on MS2 scans using a concatenated forward and reverse human reference proteome based on the FASTA file available from Uniprot (updated December 21 ...
-
bioRxiv - Immunology 2024Quote: ... the supernatant was desalted using Zeba 7 kDa spin columns (ThermoFisher) to remove free payload ...
-
bioRxiv - Microbiology 2024Quote: ... and 7 μL of antifade reagent (SlowFadeTM Gold, Invitrogen ref S36937) was added in each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Potassium chloride (7447-40-7-500G) was obtained from Fisher Scientific. Paraformaldehyde (16% ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Immunology 2024Quote: ... with 20 μg/ml of 7-aminoactinomycin D (7AAD, Invitrogen A1310) in perm/wash (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.