Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Cell Biology 2022Quote: 200,000 cardiomyocytes were incubated in Amplex Red (5 μM; 2 min) for cellular ROS (A22177, ThermoFisher), or MitoSOX Red (5 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the first wash including 5 µg/ml DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) to stain nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Bioengineering 2023Quote: A 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed according to the manufacturer’s protocol (Invitrogen). Briefly ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 2-5 million HEK293T or U937 cells using TRIzol Reagent (Ambion, 15596018). Genomic DNA was removed using DNA-free DNA removal Kit (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was incubated 2 times in RPMI 1640/5%FCS supplemented with 5mM EDTA (Gibco) for 20min each at 37°C and 200rpm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were trapped (PepMap 100 C18, 100 μm × 2 cm, 5 μM particles; Thermo Fisher Scientific) at a flow of 5 µL min-1 of 0.1 % FA ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were injected intraperitoneally with 2.5 mg of 5-ethynyl- 2’-deoxyuridine (EdU; Thermo Fisher Scientific). Lungs were harvested ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Cancer Biology 2024Quote: A 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed according to the manufacturer’s protocol (Invitrogen). Hydrogel-embedded PCLS were incubated for 16 hours in complete culture media with 10 μM EdU ...
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... After 16 h incubation at 37°C in a 5% CO2 chamber (Cytoperm 2, ThermoFisher Scientific), the culture supernatants were collected and stored at –20°C until further analysis.
-
β-1,6-glucan plays a central role in the structure and remodeling of the bilaminate fungal cell wallbioRxiv - Microbiology 2024Quote: ... After 24 h incubation at 37°C in a 5% CO2 chamber (Cytoperm 2, ThermoFisher Scientific), the culture supernatants were collected and stored at –20°C until further analysis.
-
bioRxiv - Genetics 2024Quote: ... Fungal nuclei were stained 5 min before imaging with 2 µg/ml Hoechst 33342 (Invitrogen™) in water in the dark ...
-
bioRxiv - Pathology 2024Quote: ... Rapamycin (4 mg/kg, Selleckchem) together with 5-ethynyl-2’-deoxyuridine (EdU, 50 mg/kg, ThermoFisher) diluted in 5% Tween 80 ...
-
bioRxiv - Neuroscience 2024Quote: ... Then 2-5 µg of RNA were reverse transcribed using the Superscript III reverse transcriptase (Invitrogen) and oligo dT primer (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: Unfragmented UHRR or HEK-293T RNAs (5 μg) were DNased with 2 U TURBO DNase (Invitrogen) and purified using an RNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... tightly synchronised parasites were incubated in 20 μM 5-ethynyl-2-deoxyuridine (EdU, Thermo Fisher Scientific) for 7.5 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... CD8+ T cells were cultured in a 1:1 mix of Aim 5 (Gibco) and RPMI ...
-
bioRxiv - Cell Biology 2022Quote: ... and Renilla luciferase at a 1:30:1:5 ratio using Lipofectin (Thermo Fisher) according to manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 15% FBS (Atlas Biologicals) ...
-
bioRxiv - Physiology 2020Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 15% FBS (Atlas Biologicals) ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells were incubated with 5□μg/mL of Indo□1 AM (Invitrogen) and 0.5□μg/mL of pluronic F□127 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... media was changed to 1:1 KSR:N2B media with puromycin (5 μg/ml, Gibco). On day 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 10% FBS (Cytiva HyClone) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were maintained in 5% CO2 and DMEM/F12 1:1 media (Gibco; Invitrogen) supplemented with 10% FBS (Cytiva HyClone) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% BSA and 2 mM EDTA at 1 x 106 cells per 100 μl: anti-ITGA7 APC 1:500 (Invitrogen MA5-23555) and anti-SCA-1 FITC 1:50 (BD Pharmingen 557405) ...
-
bioRxiv - Genetics 2020Quote: ... A single gRNA and single strand HDR oligo were co-transfected along with the gRNA (1-2 μg of each plasmid) into 1-2 × 106 WT ESCs using Lipofectamine 2000 (Invitrogen #1168-019) in a single well of a 6 well plate ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by culturing with the neural induction medium supplemented with 20 ng/ml human FGF-2).61 The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Bioengineering 2024Quote: ... and HITI insert were first mixed with a ratio of 2:2:1 with the reagent P3000 (ratio of DNA: P3000 of 1:2) in Opti-MEM™ Reduced Serum Medium (Gibco™), and then added to Opti-MEM™ Reduced Serum Medium (Gibco™ ...
-
bioRxiv - Genomics 2023Quote: ... coated dishes in N2 medium (high-glucose DMEM, 1% N-2, 2% B-27 and 1% penicillin/streptomycin, from Thermo Fisher Scientific) at a density of 2×105 cells/cm2 ...