Labshake search
Citations for Thermo Fisher :
7701 - 7750 of 10000+ citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed with 2% paraformaldehyde (PFA) (ThermoFisher, #43368-9M) and acquired on an Attune NxT flow cytometer ...
-
bioRxiv - Immunology 2022Quote: ... together with 2 μL 6x loading dye (Thermo Fisher Scientific). Electrophoresis was performed at 200 V for 35 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM L-glutamine and 100U/ml penicillin/streptomycin (Gibco). All cell lines were cultured at 37℃ in a humidified 5% CO2 incubator ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM L- glutamine and 100U/ml penicillin/streptomycin (Gibco). MOLT4 (male ...
-
bioRxiv - Microbiology 2022Quote: ... or 0.1 mM 5-ethynyl-2’-deoxyuridine (EdU; Life Technologies) was added for the time indicated in the text.
-
bioRxiv - Immunology 2022Quote: ... cells were pre-fixed 5min in 2% formaldehyde (ThermoFisher Scientific) before fixation and permeabilization using the Foxp3 TF buffer set (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 × 108 freshly-harvested suspension HEK Expi293F™ (ThermoFisher Scientific) cells were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Barcelona, Spain) was added for 48h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tubes were then placed on the Dynamag-2 (Thermofisher 12321D) to remove activating beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% B-27 and 0.5 mM L-glutamine (Life Technologies) or Neurobasal medium (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2020Quote: ... + 2% B-27 (minus insulin; Life Technologies, cat. 17504-044). Next ...
-
bioRxiv - Epidemiology 2019Quote: ... 10 µl 2×SYBR Green qPCR Master Mix (Thermo Scientific), and 0.5 uM primer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl ADN and 18,15µl of Ultrapure Distilled Water (Invitrogen). In the case of the 16S rRNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-Cadherin (Invitrogen clone ECCD-2, 1:500), rabbit anti-PH3 (Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15N2 L-lysine-2 HCl (Lys-8) (Thermo Fisher Scientific). Cells were kept in a humidified atmosphere with 5% CO2 at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 2 mm (for 96-well plates from Thermo Scientific), orbital shaking at 200 rpm ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 2 mmol/L L-glutamine (ThermoFisher Scientific, #25030081) and 10% FBS ...
-
bioRxiv - Neuroscience 2019Quote: ... protein concentration was measured using Qubit 2 Fluorometer (Thermo Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... and Di-8-ANEPPS (Invitrogen™, cat. D3167, 2 µM) at 5% CO2 at 37 °C for 15-20 minutes ...
-
bioRxiv - Pathology 2019Quote: ... washed 2 × TBST and mounted with Prolong Gold (Thermo Fisher) before imaging ...
-
bioRxiv - Immunology 2019Quote: ... viable cells were incubated in CellTrace Violet (2 µM; ThermoFisher) for 20 min at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... 1 µl of 2 U/µl E Coli RNaseH (Invitrogen) and then incubating at 16°C for 2 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... Drosophila Schneider 2 (S2) cells were purchased from Thermo Fisher Scientific and were grown at 26°C in Schneider media supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1 U/µL alkaline phosphatase (Thermo Fisher) and 10 µL 10 x alkaline phosphatase buffer was added and incubated at 37 °C ...
-
bioRxiv - Epidemiology 2019Quote: ... 10µL 2×SYBR Green qPCR Master Mix (Thermo Scientific, USA), and 0.5µM of each primer ...
-
bioRxiv - Zoology 2019Quote: ... containing 5 µM Fura-2 acetoxymethyl ester (Molecular Probes, Invitrogen) for 30 min at room temperature ...
-
bioRxiv - Zoology 2019Quote: ... containing 5 µM Fura-2 acetoxymethyl ester (Molecular Probes, Invitrogen) for 30 min at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... 25 mM hexafluoro-2-propanol (HFIP) (Thermo Fisher Scientific, USA) with 10 mM diisopropylamine (DIPA ...
-
bioRxiv - Bioengineering 2019Quote: ... paraffin was removed with Histoclear (Thermo Scientific; C78-2-G), the samples rehydrated ...
-
bioRxiv - Developmental Biology 2020Quote: ... supplemented with 2% fetal bovine serum (FBS; Hyclone/Thermo Scientific) and transferred to maturation medium (modified M199 medium (Sigma M2154) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µL Annexin V Alexa Fluor 657 (ThermoFisher Scientific). The cells were resuspended with pipetting and set to stain for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... HK-2 cells were cultured in Defined Keratinocyte SFM (Gibco) supplemented with 2.5 μg / 500 mL EGF recombinant human protein (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... ES-2 cells were culture in McCoy's 5A medium (Gibco) with 10% fetal bovine serum (PAN-Biotech ...
-
bioRxiv - Physiology 2020Quote: ... oligo (dT) and rhod-2 were purchased from Thermo scientific, USA.
-
bioRxiv - Microbiology 2021Quote: ... Images were taken on an EVOS FL Auto 2 (Invitrogen) using the 10x and 20x objectives (133x and 266x total magnification ...
-
bioRxiv - Neuroscience 2019Quote: ... supplemented with 2% B27 without vitamin A (Gibco, #12587-010), 1% NEAA Solution ...
-
bioRxiv - Immunology 2021Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 mM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific), 1 mM MEK inhibitor PD0325901 (1408 ...
-
bioRxiv - Immunology 2020Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μL RNAse A (10mg/mL, # EN0531, Thermo Fisher Scientific) and sonicated 30 sec on and 30 sec off for 45 min at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... centrifuged in a 2 mL glass Chromacol vial (Thermo Scientific), and resuspended in 0.5 mL MS grade methanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 2× AmpliTaq Gold® 360 Master Mix (Life Technologies, Australia), 5 pmol of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with diamidino-2-phenylindole (DAPI; Life Technologies). Secondary staining for EdU was added as the last step and stained twice to ensure signal ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of 10 μM DNTP mix (Thermo Fisher Scientific), 1 μL of 10 μM of each primer (forward and reverse ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 2 mM EDTA (PBS-EDTA) (InvitrogenTM, ThermoFisher, 16676038). The diluted blood was layered on top of the ficoll in a 2:1 diluted blood to ficoll ratio ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 2 μg/ml fibronectin (Fisher Scientific, Hanover Park, IL). Differentiated sensory neurons were maintained in N2 medium with neuronal growth factors (10 ng/ml human β-NGF ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM L-glutamine (all from Thermofisher Scientific, MA). Dissociated cortical cells from E18 Sprague Dawley rat pups were plated on slips or plates coated with poly-D-lysine (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and cultured in neurobasal medium containing 2% B27 (Life Technologies) and 1% GlutaMax (Life Technologies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... then incubated with anti mouse F(ab’)2 -Alexa647 (Invitrogen) secondary antibodies at 1:500 in PBS-1%BSA for 20 min ...