Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for Recombinant Mouse CES2E Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... the isolated recombinant EMBacY was transfected into adhesive Sf9 cells (Invitrogen) in 6-well plates ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1% human recombinant insulin and zinc solution (Gibco, 12585-014). On day 3 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 U of recombinant Taq DNA Polymerase (Thermo Fisher Scientific, Lithuania) and water to final volume of 10μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and incubated on ice for 10 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... We used GFP recombinant rabbit monoclonal antibody (G10362, Thermo Fisher Scientific) at 1:300 dilution and monoclonal anti-GFP ...
-
bioRxiv - Immunology 2021Quote: ... and 1µl of RNaseOUTTM Recombinant Ribonuclease Inhibitor (Invitrogen, Catalogue no.-10777019). 11µl of the cocktail was added to the RNA/primer mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and the lysates were incubated on ice for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... then treated with recombinant DNaseI (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human (h) PF4 was expressed in Drosophila Expression System (Invitrogen) S2 cells and purified as described22 ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant His-HMGB1 was produced in 293-freestyle cells (ThermoFisher Scientific). Purification of His-HMGB1 from 293-freestyle cell lysate was carried out using Ni SepharoseTM 6 Fast Flow gel (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 ng/mL recombinant human EGF (Thermo Fisher Scientific, Waltham, MA), 0.1 mM N-acetyl-L-cysteine (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Purified recombinant human p38α (MAPK14, GST-tagged, Thermo Fisher Scientific, #PV3304), p38β (MAPK11 ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2022Quote: Cells and mouse tissues were lysed in M-PER or T-PER Tissue Protein Extraction Reagent (Thermo Fisher Scientific) containing additional 1X PhosStop (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were extracted from cultured cells or mouse tissue (skeletal muscle, lungs) using 1X DPBS (Thermo Fisher Scientific 14190144) supplemented with 0.5% IGEPAL CA-630 ...
-
bioRxiv - Biochemistry 2020Quote: ... Binding of the full-length S protein was detected by mouse anti-His IgG (Invitrogen MA121315, 2 μg/ml) and Alexa Fluor-488-labelled goat anti-mouse IgG (Invitrogen A11001 ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse IgG (1:5000) and detection of protein was conducted using ECL Western blotting reagents (Thermo Fisher). All Western blots are representative images from at least three biological replicates.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mice were bled and total IgG (mouse and human) was pulled down using protein A beads (ThermoFisher, Catalog # 20333). An in–house sandwich ELISA was used to measure human IgG (control IgG or MS-Hu6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Acquired MS/MS spectra were searched against the mouse Uniprot protein database using SEQUEST and the Percolator validator algorithms in Proteome Discoverer 2.2 (ThermoFisher). The precursor ion tolerance was set at 10 ppm and the fragment ions tolerance at 0.02 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced to low serum RPMI (RPMI-1640 supplemented with 1% HS and 1% FBS) with 50 ng/ml NGF 2.5S Native Mouse Protein (Gibco) to differentiate cells for desired time ...