Labshake search
Citations for Thermo Fisher :
701 - 750 of 7391 citations for Recombinant Human Histidine rich Glycoprotein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant (Thermo Fisher Scientific, #10342020), and specific oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Immunology 2022Quote: ... Glycoproteins were produced by transient transfection of exponentially growing Freestyle 293-F suspension cells (Thermo Fisher Scientific, Waltham, MA) using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2.16 μg of the vector expressing the VSV-G envelope glycoprotein (pMD2.G) were mixed with OptiMEM (Gibco) to a final volume of 400 μl ...
-
bioRxiv - Biochemistry 2022Quote: ... Glycoproteins were produced by transient transfection of exponentially growing Freestyle 293-F suspension cells (Thermo Fisher Scientific, Waltham, MA) using polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2020Quote: ... media with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant epidermal growth factor (Gibco - Thermo Fisher Scientific, MA, USA). All culture conditions contained a 5% antibiotic / antimycotic mixed solution (Nacalai Tesque) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 1 week at a density of 106/well in 6 well plates with 50 ng/ml recombinant human macrophage colony stimulating factor (M-CSF) (Life Technologies, Carlsbad, CA), 1x GlutaMAX-I (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... cells at the end of 1-day culture were pulsed for 20 minutes with 40 ng/ml of recombinant human IFN-γ (Gibco/Thermo Fisher), 100 IU/ml of recombinant human IL-2 (Roche Diagnostics ...
-
bioRxiv - Bioengineering 2023Quote: ESCs were maintained on Recombinant Human Protein Vitronectin (Thermo Fischer # A14700) coated plates using mESC maintenance media containing Glasgow Minimum Essential Medium (Thermo Fisher Scientific # 11710035), Embryonic Stem Cell-Qualified Fetal Bovine Serum (Thermo Fisher Scientific # 10439001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells stably expressing human recombinant LOXL1 were maintained in culture (37°C, 5% CO2) at log-phase growth in advanced DMEM (Thermo Fisher Scientific, 12491015) with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... the first exon of HRI was amplified by PCR using primers located within the promoter and first intron (Forward: CTAGCTGCAGCATCGGAGT, Reverse: GAGGCAGACGTTCTTTTCAA) using AccuPrime G-C rich polymerase (Invitrogen). Amplicons were cloned into pGEM-T Easy vector (Promega ...
-
bioRxiv - Genetics 2021Quote: ... The genomic region surrounding the CRISPR/Cas9 target site (741 bp) was PCR amplified using AccuPrime GC-Rich DNA Polymerase (Invitrogen) (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... falciparum cell lines were maintained in human O+ erythrocyte cultures with a 2.5% haematocrit in RPMI 1640 medium supplemented with 0.5% AlbuMAX II Lipid Rich bovine serum albumin (Thermo Fisher Scientific), 25 mM Hepes (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... 5% (v/v) DMSO if the sequence was GC-rich and UltraPure DNase/RNase-free distilled water (Invitrogen; cat # 10977015) to a final volume of 20 μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Cell Biology 2019Quote: ... The plasmids encoding for His-SEPT2 or His-SEPT2-mCherry and SEPT6/7-strep were co-transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 2-3 and induced with 1 mM IPTG for 1h at 37°C (His-SEPT2 ...
-
bioRxiv - Immunology 2021Quote: ... RBD-His and Spike-his containing supernatants were batch purified using the HisPur™ Ni-NTA Resin (ThermoFisher Scientific). Supernatants were incubated with 6 ml of resin for 1h at RT ...
-
bioRxiv - Cell Biology 2020Quote: To compare the presence of the nucleolar rim of mNG-tagged proteins in live and fixed cells we fixed mNG-tagged cells in 4% formaldehyde (Thermo Scientific, 28908).
-
bioRxiv - Cell Biology 2021Quote: ... AnkB440 KO primary cortical neurons were transfected with Halo-tagged AnkB440 or GFP-tagged AnkB220 plasmids at DIV0 by lipofection (Lipofectamine 2000, Thermo Fisher Scientific). After brain dissociation ...
-
bioRxiv - Immunology 2022Quote: ... of the different constructs were ordered and cloned into a pPPI4 avidin-tagged and/or hexahistidine-tagged vector by PstI-BamHI digestion and ligation with Gibson Assembly (Thermo Fisher Scientific). The recombinant human ACE-2 receptor was obtained in the same way after ordering the corresponding gBlock gene fragment (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mCherry tagged SETD6 WT or Y285A and EGFP-tagged E2F1 WT or K117R were co-transfected into cells using polyethyleneimine (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 pmol (77 nM) of recombinant dynein tail complex or recombinant protein A (ThermoFisher Scientific) were incubated with 100 μL IgG magnetic beads in 1300 μL IgG binding buffer with rotation for 1 h at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The secondary antibodies tagged with Alexa Fluor 647 (Invitrogen) at 5 μg/mL were added to the slices and incubated for 1 h before three-times washing and imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... or Alexa647-tagged antisera (1:500; Invitrogen, Karlsruhe, Germany) in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... tagged with Alexa Fluor 594 or 488 dyes (Invitrogen), and the signal enzymatically augmented with sequential tyramide signal amplification (TSA amplification kits ...
-
bioRxiv - Physiology 2020Quote: ... Amp-3 and HRP-tagged probe (Thermo Fisher Inc), one drop each for 30 ...
-
bioRxiv - Immunology 2021Quote: ... and Rhodamine or Alexa Fluor 488-tagged Phalloidin (Invitrogen) were used for counterstaining cells ...
-
bioRxiv - Plant Biology 2023Quote: ... antibodies and detected using fluorescently tagged secondary antibodies (Invitrogen, goat raised anti-mouse 488 and Anti-rabbit 555) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Whi5 tagged with GFP was obtained from Thermo Fisher Scientific GFP yeast clone collection ...
-
bioRxiv - Biochemistry 2019Quote: ... pET151/D-TOPO plasmids with the sequences of interest inserted under control of Lac operon and T7 viral promoter with N-terminal hexa-histidine tag and Ampicillin selection marker was obtained from Invitrogen. Sequences were optimized for expression in E ...
-
bioRxiv - Biochemistry 2022Quote: The T7 gp5.9 gene from phage T7 was produced as a synthetic gene construct with an N-terminal 3C-cleavable histidine tag (GeneArt, Invitrogen). This was subcloned into the pACEBAC1 (MultiBac ...
-
bioRxiv - Microbiology 2024Quote: ... They were produced with a histidine-tag in the Bac-to-Bac™ Baculovirus Expression System (Invitrogen, for VP3 proteins) or Escherichia coli prokaryotic system (for 2xFYVE) ...
-
bioRxiv - Microbiology 2020Quote: ... HK-2 cells were maintained in keratinocyte serum-free (KSF) media with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human recombinant epidermal growth factor (Gibco - Thermo Fisher Scientific, MA, USA). All culture conditions contained a 5% antibiotic / antimycotic mixed solution (Nacalai Tesque) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant human IFNγ (285-IF) was purchased from R & D Systems (Minneapolis, MN) and mouse IFNγ (BMS326) from eBioscience (Thermo Fisher Scientific, Waltham, MA). The following antibodies were used for Western blot ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 5% fetal bovine serum except for RWPE-1 and RWPE-2 cell lines which were grown in a keratinocyte serum-free medium supplemented with 5 ng/mL recombinant human epidermal growth factor (EGF) and 50 μg/mL bovine pituitary extract (Gibco™, Invitrogen, Carlsbad, CA, USA). The cell lines were tested for short tandem repeat (STR ...
-
bioRxiv - Cancer Biology 2024Quote: ... PWR-1E and PIN cells were cultured in Keratinocyte Serum-Free Medium supplemented with bovine pituitary extract and recombinant human epidermal growth factor (Gibco, Life Technologies, Grand Island, NY). Myc-CaP ...
-
bioRxiv - Biochemistry 2021Quote: ... 1% PenStrep and transfected with plasmids encoding for the corresponding S glycoprotein (24 µg/dish) using lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Filaments extracted from gerbera were subjected to SDS-PAGE and then the Pierce™ Glycoprotein Staining Kit (ThermoFisher Scientific, USA) was used as directed ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 3.5 µg of pCAGGS SARS CoV-2 S Glycoprotein expression vector DNA (NR52310, BEI, USA) in a total of 10 ml of Opti-MEM media (Invitrogen). The day following transfection the media was changed to DMEM10 complete media and samples were placed at 37 °C and 5% CO2 for 48 h ...
-
bioRxiv - Molecular Biology 2021Quote: The wild-type and mutant SARS-CoV-2 S glycoproteins were expressed transiently by a pcDNA3.1(-) vector (Thermo Fisher Scientific) (29) ...
-
bioRxiv - Microbiology 2021Quote: CHO cells stably expressing SARS-CoV-2 S-glycoprotein were seeded in 96 well plates for microscopy (Thermo Fisher Scientific) at 12’500 cells/well and the following day ...
-
bioRxiv - Biochemistry 2021Quote: ... an equivalent of 1 μg glycoprotein digest was loaded onto an Acclaim PepMap RSLC C18 column (Thermo Fisher Scientific, Lithuania) and separated at a flow rate of 300nL/min using a gradient of 5% to 40% solvent B (80% acetonitrile with 0.1% formic acid ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 μg of plasmid VSV-G encoding G glycoprotein of vesicular stomatitis virus(VSVG) using Lipofectamine 3000 Reagent (Invitrogen). 12 h later ...
-
bioRxiv - Microbiology 2020Quote: The wild-type and mutant SARS-CoV-2 S glycoproteins were expressed transiently by a pcDNA3.1(-) vector (Thermo Fisher Scientific). The wild-type SARS-CoV-2 spike (S ...
-
bioRxiv - Microbiology 2021Quote: ... and glycol-proteins and the DNase/Proteinase K treated matrix samples with the Pro-Q Emerald 300 glycoprotein stain (ThermoFisher).
-
bioRxiv - Immunology 2021Quote: Hela cells stably-expressing EGFP-tagged NLRP3 and mApple-tagged RAB5A were seeded into Nunc™ Lab-Tek™ 8-well Chambered Coverglass (155411, ThermoFisher Scientific) on the day before experiments ...
-
bioRxiv - Biochemistry 2020Quote: CHO-K1 cells in 10-cm dishes were transfected with complementary DNA encoding FLAG-tagged mLPCAT2 or one of several FLAG-tagged mLPCAT2 mutants using Lipofectamine 2000 (Thermo Fisher Scientific, USA). At 48 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable transformants of ZP161 expressing rat Pex14 variants tagged with N-terminal hexahistidine (His-Pex14) were isolated by transfection of pcDNAZeo-D/His-RnPEX14 variants (see below) followed by selection with Zeocin (Invitrogen), as described (Okumoto et al. ...
-
Lactic Acid Containing Polymers Produced in Engineered Sinorhizobium meliloti and Pseudomonas putidabioRxiv - Microbiology 2019Quote: ... the gel was used for His-tag staining following the InVision(tm) His-tag In-Gel Stain protocol provided by Invitrogen.
-
bioRxiv - Immunology 2022Quote: ... pAc5.1A/V5-His-CBF and pAc5.1A/V5-His-EF-1α were transfected into S2 cells using Cellfectin II Reagent (Invitrogen, USA), respectively ...