Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for Coatomer Subunit Epsilon COPE Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... an equal volume of 0.04 mg/mL FITC-casein (Thermo Scientific™, 23267), 4 mM ATP (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... and fluorescein-5-isothiocyanate (FITC) was purchased from Fisher Scientific (Waltham, MA, USA). 1,10-Dioctadecyl-3,3,30,30-tetramethylindotricarbocyanine iodide (DiR ...
-
bioRxiv - Immunology 2024Quote: ... anti-MHCII (APC) and anti-CD86 (FITC) (Thermo Fisher Scientific, Waltham, MA, USA). As a positive control for inflammasome induction ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1.5 µl of 10% (w/v) 3kD FITC dextran (D3306, Life Technologies), diluted in aCSF (149 mM NaCl ...
-
bioRxiv - Immunology 2024Quote: ... anti-F4/80 FITC (1:200, Cat# 11-4801-82, Thermo Fisher Scientific), and anti-Phospho-S6 (Ser235/236 ...
-
bioRxiv - Immunology 2024Quote: ... including IFN-γ FITC (1:100; Invitrogen; clone 4S.B3; Cat# 11-7319-82) and Granzyme B PE (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected into the soleus muscle and Alexa Fluor 488-conjugated Cholera Toxin subunit B (CTB 488, Thermo Fisher Scientific, 0.05% in 5 µL PBS) into the gastrocnemius muscle ...
-
bioRxiv - Neuroscience 2024Quote: WT and Fmr1 KO mice (4 months-old) received a bilateral injection of CholeraToxin (β subunit) conjugated to Alexa Fluor™ 555 Conjugate (catalog number: C34776; Invitrogen™, Carlsbad, CA). Prior to the injections ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pre-warmed coating solution composed of 0.1 mg/ml FITC-gelatin (#G-13187, Invitrogen) and 10 μg/ml laminin (#23017-015 ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 2h together with phalloidin-FITC (Molecular Probes Inc, Eugene, OR, USA). Coverslips were mounted on microscopy slides and visualized with a HC PL APO 63x/1.40 Oil CS objective lens attached to a Leica TCS-SP5 II confocal microscope (Leica Microsystems ...
-
bioRxiv - Biochemistry 2020Quote: ... Wells without FITC-rhPRG4 were probed with anti PRG4 Ab LPN (1:500, Invitrogen) in blocking solution overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with streptavidin fluorescein (FITC) conjugated (1:400) (Thermo Fisher Scientific, Canada) on a shaker at 4°C for 12 hours ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC conjugated F(ab’)2 goat anti-human IgA (Thermo Fisher Scientific, Illkirch, France), Brilliant Violet 650 conjugated streptavidin (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... then analyzed for viability using the FITC Annexin V Apoptosis Detection Kit (Thermo Scientific). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... The biotinylated whole-cell lysate was then added to FITC neutravidin beads (ThermoFisher, F8776) at a ratio of 5µg antigen:1µL beads ...
-
bioRxiv - Developmental Biology 2020Quote: ... Probes labeled with biotin-16-dUTP were detected using avidin-FITC conjugate (Fisher Scientific) and probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... The concentration of a FITC-labeled repebody was measured by NanoDrop 2000c (Thermo Scientific). For confocal microscopy ...
-
bioRxiv - Immunology 2021Quote: ... cells from spleen and liver were stained with Annexin V-FITC (V13242 from Invitrogen) and LIVE/DEAD Near IR (L34976 from Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Apoptosis was measured using the FITC Annexin V/Dead Cell Apoptosis Kit (Invitrogen, V13242). For cell cycle analysis ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were incubated with 0.5 μm FITC-labeled microspheres (F8813, Thermo Fisher, Waltham, MA) at a concentration of 5 × 108 microspheres/ml for 1 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: Cells were stained with calcofluor and FITC-conjugated wheat germ agglutinin (WGA: Molecular Probes) to visualize chitin ...
-
bioRxiv - Microbiology 2022Quote: ... stained using FITC-conjugated F(ab’)2-Goat anti-human IgA (Invitrogen; 1/1000) in PBS + 0.1% BSA for 20 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... hMSCsshCtl and hMSCsshSTC1 were isolated and stained with annexin V-FITC and PI (Invitrogen), then apoptosis-positive cells were analyzed using FACS (Millipore Muse).
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg mL-1 10,000 MW FITC lysine charged dextran (ThermoFisher Scientific, Waltham, MA) and 50 ng µL-1 of Renilla Luciferase (RLuc ...
-
bioRxiv - Cancer Biology 2022Quote: ... samples were washed and stained for CD11b conjugated to FITC (#11-0118-42, Thermofisher), then fixed and analysed on the BD LSR II ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... L-histidine and fluorescein isothiocyanate isomer I (FITC) were from Acros Organics (Geel, Belgium). D- mannitol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were stained with FITC Annexin V (Bio Legend) and propidium iodide (Invitrogen) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... The apoptosis was measured by eBioscienc Annexin V apoptosis detection kit FITC (Thermo Fisher). Flow cytometry analysis was performed using an Amnis FlowSight flow cytometer (Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... or stained with rabbit IgG Isotype Control-FITC (Invitrogen, Cat# PA5-23092, RRID: AB_2540619) in Flow Cytometry Staining Buffer (2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... then washed and stained with FITC-annexin V and propidium iodide (PI; ThermoFisher Scientific) to detect dead and dying cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Media in the upper well was replaced 0.1mg/mL 10kDa Dextran-FITC (D1820, Invitrogen) in culture media ...
-
bioRxiv - Cancer Biology 2023Quote: ... or stained with rabbit IgG Isotype Control-FITC (Invitrogen, Cat# PA5-23092, RRID: AB_2540619) in flow cytometry staining buffer (2% FBS ...
-
bioRxiv - Immunology 2024Quote: ... washed and incubated either with a goat anti-mouse IgG (H+L)-FITC (Invitrogen) or with a biotin-coupled anti-mouse IgG F(abߣ)2 (Jackson Immunoresearch) ...
-
bioRxiv - Developmental Biology 2024Quote: ... F-Actin cytoskeleton was labeled using Phalloidin coupled with FITC fluorophore (1:1000; ThermoFisher). Fluorescence images were taken on an EVOS Cell Imaging System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then incubated with IL-17A FITC (clone: eBio17B7, 11-7177-81; Invitrogen), IL-13 PE (clone ...
-
bioRxiv - Neuroscience 2024Quote: ... SVG astrocytes were also monitored for viability (GFAP, FITC ThermoFisher Scientific 53-9892-82).
-
bioRxiv - Neuroscience 2024Quote: ... MHC-II FITC (clone M5/114.15.2, Invitrogen, 11-5321-82, 2442242, 1:100 dilution). For Panel 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... This was followed by a 90-minute incubation with CD34-FITC (Thermo Fisher Scientific), Sca1-PE (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Between 25-35ug nuclear extract was separated on home-made SDS-PAGE gels or NuPAGE™ 3-8% Tris-Acetate gels (Life Technologies, for large Mediator subunits). Gels were blotted onto nitrocellulose membranes using the Trans-Blot Turbo transfer system (BioRad) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cDNA plasmids in pcDNA™4/TO Mammalian Expression Vector were transiently transfected into Expi293F™ cells stably expressing human FHF2b and human SCN1B subunit (polyclonal) background using ExpiFectamine™ 293 Transfection Kits (Gibco,Thermo Fisher Scientific CAT #: A14524). Induction was achieved using Tetracycline (Sigma Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... Female and male genomic DNA was labelled with FITC-dUTP (Thermo Fisher Scientific-Molecular Probes) and CyDye3-dUTP (GE Healthcare ...
-
bioRxiv - Genomics 2020Quote: ... Female and male genomic DNA was labelled with FITC-dUTP (Thermo Fisher Scientific-Molecular Probes) and CyDye3-dUTP (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... ref: 00-5523-00) before incubation overnight with Arg1 FITC (Ref: 53-3697-82, Thermofisher), and iNOS PE (Ref ...
-
bioRxiv - Immunology 2022Quote: ... Labelling of pDCs: primary: anti-SiglecH-PE/FITC or BST2 (CD317/PDCA-1-ThermoFisher-eBioscience) rat anti-mouse purified ...
-
bioRxiv - Physiology 2022Quote: ... dissolved in in PBS was reacted with 1.6 ml of 4 mg/ml FITC (ThermoFisher) for 1 hour and fibrinogen was dialyzed 4 times to 4L each time of PBS ...
-
bioRxiv - Immunology 2021Quote: ... and stained with an anti-Guinea Pig Complement C3 FITC (polyclonal, ThermoFisher Scientific, Waltham, MA). Cells were then fixed with 4% formaldehyde solution and fluorescence was evaluated on a LSRII flow cytometer (BD Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... conjugation of Cy5 and FITC was achieved using Amersham (GE Heathcare) and Molecular Probes (Invitrogen) labeling kits ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 mg/l 5-(and-6)-carboxyfluorescein and succinimidyl ester (FITC; Thermo Fisher Scientific), respectively ...