Labshake search
Citations for Thermo Fisher :
701 - 750 of 9462 citations for 9 3 bromophenyl 9 phenyl 9H fluorene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The immortalized bladder epithelial cell line 5637 (ATCC HTB-9) was grown statically at 37 °C in RPMI 1640 (Life Technologies Co., Grand Island, NY) media supplemented with 10% FBS under 5% CO2.
-
bioRxiv - Cell Biology 2024Quote: ... 1.9 µm beads-EV1106 column using an Evosep one HPLC system coupled to an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher, San José, CA, USA) and a 30 SPD preprogramed gradient.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.9 µm beads-EV1106 column using an Evosep one HPLC system coupled to an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher, San José, CA, USA) and a 30 SPD preprogramed gradient.
-
bioRxiv - Cancer Biology 2024Quote: ... for 48 hours and analyzed by flow cytometry either five days post-selection for Cas9 stable lines or 5-days post-induction with 1 μg/mL doxycycline (Thermo Scientific Chemicals, 10592-13-9) for Cas9 inducible lines ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2.5x103 HMEC1-BFP cells and 2.5x103 NHDF-iRFP cells were embedded per µl of Geltrex LDEV-free reduced growth factor basement membrane matrix ( a soluble form of basement membrane extracted from murine Engelbreth-Holm-Swarm tumours; Gibco, final concentration around 9 mg/mL). 2 µl of the cell-matrix mix was added to each gel inlet channel of a 3lane40 OrganoPlate (Mimetas) ...
-
bioRxiv - Biochemistry 2022Quote: ... Para-nitro-phenyl phosphate (pNPP) sodium salt was obtained from Thermo Scientific.
-
bioRxiv - Cancer Biology 2021Quote: qPCR was performed with 9 ng cDNA, Taqman™ Gene Expression Master Mix (#4369016, ThermoFisherScientific, Waltham, Massachusetts, USA) and the respective TaqMan™ probes (Applied Biosystems, Foster City, California, USA). The following probes were used ...
-
bioRxiv - Microbiology 2024Quote: ... Then biofilms were dyed with the mixture of SYTO-9 and propidium iodide (PI) dyes (FilmTracer™ LIVE/DEAD® Biofilm Viability kit, Invitrogen, Ltd., Paisley PA4 9RF, UK) to visualize live and dead cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Microbiology 2020Quote: ... as well as the fluorescent probe N-phenyl-1-naphthylamine (NPN; Acros Organics, USA) at a final concentration of 10 μM ...
-
bioRxiv - Bioengineering 2023Quote: ... in anE3 medium supplemented with 30 mg/ml 1-phenyl-2-thiourea (PTU, Acros Organics) from 24 hpf ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg/ml L-(tosylamido-2-phenyl ethyl) chloromethyl ketone (TPCK)-treated trypsin (Thermo Scientific Pierce), and 1x antibiotic-antimycotic (Corning) ...
-
bioRxiv - Immunology 2023Quote: ... and 0.1% L-(tosylamindo-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Affymetrix, Cleveland, OH, USA). Lastly ...
-
bioRxiv - Immunology 2024Quote: ... 1 µg/mL L-(tosylamido-2-phenyl ethyl) chloromethyl ketone (TPCK)-treated trypsin (Thermo Scientific Pierce), and 1× antibiotic-antimycotic60,61 ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μg/mL L-(tosylamido-2-phenyl ethyl) chloromethyl ketone (TPCK)-treated trypsin (Thermo Scientific Pierce), and 1× antibiotic-antimycotic (Corning) ...
-
bioRxiv - Biophysics 2021Quote: ... Membranes were stained with 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate (TMA-DPH; Molecular Probes) at a final concentration of 100 μM and the cells were then immobilized on a 2% agarose pad made with sporulation buffer covered with a no.1.5 coverslip ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants were aspirated and pellets were resuspended in 3-5 µL of 1X PBS containing 0.02 mM 1-(4-(trimethylamino) phenyl)-6-phenylhexa-1,3,5-triene (TMA-DPH)(Invitrogen).Cells were mounted on glass slides with polylysine-treated coverslips ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 32°C in E3 medium supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) from 8 hpf to prevent pigmentation ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4969-Diamidino-2-phenyl-indole (DAPI) for the nuclear staining was purchased from Life Technologies (Grand Island, NY). Dimethylsulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM disuccinimidyl suberate (DSS) or 2 mM tert-butyl disuccinimidyl phenyl phosphonate (tBu-PhoX)(Thermo Fisher Scientific) in DMSO was added to the solution and incubated for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Microbiology 2020Quote: The lipophilic fluorescent membrane probe 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH) (Themo Fisher Scientific) was used to assess EV associated lipids ...
-
bioRxiv - Developmental Biology 2024Quote: ... Medium was replaced daily from 8 hpf and supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Larvae were then kept at 28.5°C with fresh E3 medium supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics). Around 3-4 hours after heat-shock ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... LC conditions were as follows: column: Accucore Phenyl-Hexyl (2.6 µm, 100 x 2.1 mm; Thermo Fisher, Dreieich, Germany); temperature 40 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... column and the sample chamber was filled with E3 supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) and 0.04% tricaine methanesulfonate (MS-222 ...
-
bioRxiv - Developmental Biology 2024Quote: ... in facility water (2-month-old fish) or an E3 solution supplemented with 0.2 mM 1-phenyl-2-thiourea (PTU; Acros Organics) (larvae) ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Immunology 2022Quote: ... the captured viral biotinylated peptides were detected with 1 mg/ml pNPP (p-nitro-phenyl-phosphate, Thermo Fisher Scientific, cat: 34045) diluted in Diethanolamine substrate buffer 1X (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and replaced with 200µl of fresh medium supplemented with 1nM phenyl thiourea and Texas red-conjugated Escherichia coli K-12 particles (Molecular Probes BioParticles® E-2863) for a density of 53000 particles/mm2 and incubated for 1 h at room temperature in the dark ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...