Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Cancer Biology 2024Quote: ... EDTA was added to the samples at a final concentration of 5 mM and the suspension was diluted 1:5 in collection buffer (2 % heat-inactivated fetal bovine serum, Life Technologies; 26140079 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed 3×5 min in PBS and incubated for 2 h with an Alexa Fluor® Plus 555-conjugated secondary antibody (Invitrogen A32816) diluted in the blocking solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’TYE563-labeled locked nucleic acid probes (Exiqon) against mouse major satellite sequences (Supplementary Table 5) were precipitated with mouse Cot-1 DNA (Invitrogen) and Salmon Sperm DNA (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... KIF18A siRNAs used were a 1:1 mixture of two the following Silencer or Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334), GCUUGUUCCAGAAUCGAGAtt (Ambion ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF18A siRNA used was a 1:1 mixture of the following two Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334) CGUUAACUGCAGACGUAAAtt (Ambion ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Cell Biology 2022Quote: ... while 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine-5,5′-disulfonic acid (DilC18) was purchased from Invitrogen. All stock solutions were prepared in chloroform/methanol (2:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Neuroscience 2024Quote: Worms were exposed to 20 mM DL-3-hydroxybutyric acid sodium salt (Acros Organics) on NGM agar plates seeded with E ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 1% NEAA (non-essential amino acids, Gibco) in an incubator at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% non-essential amino acids (Life Technologies), and 0.2% penicillin-streptomycin solution (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% MEM non-essential-amino-acids (Gibco) and 1 µg/ml heparin (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM non-essential amino acids (Gibco), 100 units/ml human LIF supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% MEM non-essential amino acids (Gibco), 1% GlutaMax (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% non-essential amino acids (NEAA, Invitrogen) and 1000 U/mL LIF (ESGRO ...
-
bioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids (NEAA; Gibco) and 1% Penicillin-streptomycin (pen-strep ...
-
bioRxiv - Immunology 2021Quote: ... 1% MEM non-essential amino acids (Gibco), 1% sodium-pyruvate (Corning) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% non-essential amino acids (Life Technologies), 100 U/mL penicillin ...
-
bioRxiv - Microbiology 2021Quote: ... 1× non-essential amino acids (NEAA; Gibco), 1× penicillin-streptomycin (P/S ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM non-essential amino acids (Gibco), 1X GlutaMAX and 0.1 mM b-mercaptoethanol ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM non-essential amino acids (GIBCO) and 2% Penicillin Streptomycin (GIBCO).
-
bioRxiv - Cell Biology 2021Quote: ... in 1% formic acid (Thermo Fisher Scientific) and the supernatants were collected ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (ThermoFisher Scientific) and 1% Pen/Strep (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 mM nonessential amid acids (Gibco) in 6-well plates until sub-confluent ...
-
bioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids (Life Technologies), 100 U/mL penicillin and 100 µg/mL streptomycin (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... 1% nonessential amino acids (Gibco: 11140-050), and 0.1% β-mercaptoethanol (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids (NEAA; Gibco) and 1% Penicillin-streptomycin (pen-strep ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1% Non-essential amino acids (Gibco). Cell lines were tested negative for mycoplasm ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% non-essential amino acids (Gibco). BSC40 (African green monkey ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1% non-essential amino acids (Gibco) and plated in cell culture flasks ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% non-essential amino acids (all Gibco), 100 μM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Non-Essential Amino Acids (Life Technologies), 2 mM L-Glutamine (Life Technologies) ...