Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 3 Chloro 2 Trimethylsiloxypropene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Microbiology 2024Quote: ... and 3% _-glutamine (Gibco). Madin-Darby canine kidney (MDCK ...
-
bioRxiv - Microbiology 2024Quote: ... or TOPO-3 (Invitrogen) for 10 mins ...
-
bioRxiv - Microbiology 2024Quote: DiOC2(3) (Thermo Scientific) exhibits green fluorescence in all bacterial cells at low concentrations ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 % B27 (Gibco, 17504044), 0.1 % Glutamax ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-3-PGK (Invitrogen) was used at a 1:8000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were injected into a C-18 trap column (Acclaim PepMap100, 75 μm i. d. x 2 cm, C18, 3 μm, 100 Å, Thermo Fisher Scientific) and further separated on a C-18 analytical column (Acclaim PepMap100 ...
-
bioRxiv - Cell Biology 2020Quote: ... in PBS and incubated for 2-3 hr in secondary antibodies (conjugated to Alexa-488, Alexa-568, and Alexa 647, Life Technologies,1:500) at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2020Quote: ... Rehydrated embryos were blocked with 10% BSA (in PBST) for 2-3 hours and incubated with anti-GFP antibody (1:1000; ThermoFisher Scientific, A-11120) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with 100 ng/ml LPS for 3 hr followed by incubation with 2 µM Mitosox red (Thermo Fisher Scientific, M36008) for 30min ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293T cells were seeded into 12-well plates and were transfected with 1.5 μg the RPL plasmid and 0.5 μg Cas13b gRNAs (NTC, U1-1, U1-2, U1-3) while ∼80% confluency using Lipofectamine 3000 (Thermo Fisher Scientific, Cat.# L3000015). For RIP experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... They were maintained on irradiated mouse embryonic fibroblast feeder cells (p2 DR4 expanded MEFs from WT-MRC Cambridge Stem Cell Institute) and were passaged every 2-3 days using TrypLE (Thermo Fisher Scientific, 12605028). ROCK inhibitor (10μM ...
-
bioRxiv - Cancer Biology 2020Quote: ... an aliquot of each enriched sample was injected onto a trap column (Acclaim® PepMap 100 pre-column, 75 μm × 2 cm, 3 μm, 100 Å, Thermo Scientific) coupled to an analytical column (EASY-Spray PepMap column ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from 2×106 cells (3 biological replicates for wild-type and CNOT3-DM cells) using Trizol reagent (Thermo Fisher Scientific, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and loaded onto a reverse phase trap column (Acclaim PepMap 100, 75µm x 2 cm, nano viper, C18, 3 µm, 100 Å, ThermoFisher, Waltham, MA, U.S.A.) using an Ultimate 3000 for 50 µL at a flow rate of 10 µL min-1 ...
-
bioRxiv - Immunology 2021Quote: ... Peptides were initially trapped on a 2 cm long trap column (Acclaim PepMap100, 3 μm C18 particle size, 100 Å pore size, 75 μm inner diameter, Thermo Fisher Scientific) for 10 min at a flow rate of 6 μl/min with 0.1 % (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were loaded on an Acclaim® PepMap 100 pre-column (100 µm × 2 cm, C18, 3 µm, 100 Å; Thermo Fisher Scientific) with 0.07% trifluoroacetic acid ...
-
bioRxiv - Plant Biology 2021Quote: ... Five microliters of peptide mixtures were loaded onto an Acclaim PepMap™ precolumn (75 μm × 2 cm, 3 μm, 100 Å; Thermo Scientific) equilibrated in solvent A and separated at a constant flow rate of 250 nl/min on a PepMap™ RSLC C18 Easy-Spray column (75 μm × 50 cm ...
-
bioRxiv - Microbiology 2020Quote: ... Aliquots of each sample were loaded onto a trap column (Acclaim® PepMap 100 pre-column, 75 μm × 2 cm, C18, 3 μm, 100 Å, Thermo Scientific) connected to an analytical column (EASY-Spray column ...
-
bioRxiv - Biophysics 2021Quote: ... cells were incubated in blocking buffer with 8 ng/μL of custom labeled secondary antibodies or of commercial IgG-gam-F(ab’)2-Alexa Fluor 647 (DOL ~ 3) (Thermo Fisher, A-21237) for 45 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were harvested and fixed with 3 % PFA for 15 minutes and then stained with 2 μM of CellTracker™ fluorescent probes (ThermoFisher Scientific #C34552). Z-stacks were taken using a Leica TCS SP5 Matrix confocal microscope with the 20X objective ...
-
bioRxiv - Cell Biology 2020Quote: Fibroblasts were plated in 96-well plates (10,000 fibroblasts/well) for 3 days in 2% FBS in DMEM supplemented with ascorbic acid (50 μg/mL) (Fisher Scientific, Waltham, MA, USA). Fibroblasts and matrix were then fixed and immunostained as detailed above ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific, Thermo Fisher Scientific) and dried ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific, Thermo Fisher Scientific) and dried ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were loaded onto an Acclaim Pepmap 100 C18 trap column (75 μm x 2 cm nanoViper, 3 μm, 100 Å) (Thermo Fisher Scientific) at 2 μL/min ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Microbiology 2021Quote: ... The phospholipolytic activity was measured according to 83 using a synthetic fluorescent substrate 1-palmitoyl-2-(10-pyrenyldecanoyl)-sn-glycero-3-phosphocholine (Molecular Probes, The Netherlands) and a Hitachi F-4000 spectrofluorimeter.
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Evolutionary Biology 2022Quote: ... through PCR amplification using pair of primers 2 and 3 (Table S1) with a 2X Phusion Flash PCR Master Mix (Thermo Scientific, Cat. # F548S). Gibson Assembly (New England Biolabs ...