Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 200 ng of Asp-N endoproteinase (Thermo Scientific) was then added for another overnight incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... and N-ethylmaleimide (Acros organics, 128-53-0)] and then washed with CEB buffer (CEBN buffer without NP-40 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1X N-2 Supplement (Thermo Fisher, Cat#17502048), 100U/mL penicillin-streptomycin (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... N-hydroxysulfosuccinimide (Sulfo-NHS, Thermo Fisher Scientific 24510), N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 1% (v/v) N-2 (Invitrogen), 5 µg/ml insulin (Merck) ...
-
bioRxiv - Bioengineering 2023Quote: ... and n-isopropylacrylamide (1524.94 mg, Thermo Fisher Scientific) were added to a glass vial containing (GT)15-SWCNTs in 1X PBS (1 mg/L ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 1x N-2 supplement (ThermoFisher, 17502048), 1x B-27 supplement (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with N-2 supplement (Invitrogen Cat. #17502048), B-27 supplement minus vitamin A (Invitrogen Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... N,Ndiisopropylethylamine (DIPEA) was purchased from Fisher Scientific. Analytical reversed-phase HPLC (RP-HPLC ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x N-2 supplement (Gibco, 17502-048)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-N SARS-CoV-2 (MA5-38034, Invitrogen), anti-NSP1 SARS-CoV-2 (STJ11103222 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1X N-2 (Life Technologies, cat# 17502-048); 5 μg mL-1 insulin ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.5 v/v% N-butyldiethanolamine (Thermo Scientific) in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... then adding 1X N-2 (Gibco™ 17502001), 1X B-27 (Gibco™ 17504001 ...
-
bioRxiv - Genomics 2024Quote: ... 1X N-2 Supplement (Life Technologies, 17502-048), 1X NEAA (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 1X N-2 Supplement (Thermo Fisher Scientific # 17502048), 1X Chemically Defined Lipid Concentrate (Thermo Fisher Scientific # 11905031 ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 1% N-2 (Thermo Scientific, 17502048), 2% NeuroCult SM1 (Stemcell technologies ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 × N-2 Supplement (Gibco; Cat. No. 17502048), 0.5X B-27 Supplement (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gibco N-2 Supplement (1:100, Life Technologies), N-Acetylcysteine (0.5M ...
-
bioRxiv - Pathology 2024Quote: ... Silencer Select Negative Control n°2 (Life Technologies) was used as a control (siCtrl).
-
bioRxiv - Neuroscience 2024Quote: ... 1X N-2 Supplement (Thermo Fisher Scientific # 17502048), 1X Chemically Defined Lipid Concentrate (Thermo Fisher Scientific # 11905031) ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 mM N-ethyl maleimide (NEM) (Thermo Scientific) was added and the mixture was further incubated for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.5 ml (Thermo Fisher Scientific, cat. n.° AM12300)
-
bioRxiv - Cancer Biology 2024Quote: ... HIF1A (Fisher Scientific, Cat#: BDB610959; RRID: N/A), EGLN1 (Cell Signaling Tech ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 25 mM N-ethylmaleimide (Thermo Scientific 040526.06). The final concentrations of ammonium formate and NEM in the extraction solvent were 2 mM and 5 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-N-cadherin (1:250; Invitrogen 99-3900), Secondary antibodies used were goat anti-mouse or anti-rabbit IgG conjugated to A488 ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with N-2 Supplement (100×) (Gibco, 17502048), B27 supplement (50× ...
-
bioRxiv - Pathology 2022Quote: The LBs in 6-well plates at 1×106 cells/mL were incubated with 10 μM ROS probe CM-H2DCFDA (chloromethyl dichlorodihydrofluorescein diacetate, acetyl ester, Invitrogen, cat. 6827) in phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... For staining Acetyl Choline receptors (AChRs) we incubated embryos with 1:100 α-Bungarotoxin (α-BTX)-555 conjugate (Thermo Fisher Scientific-B35451) at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: Hydrogen peroxide quantification in systemic leaves was performed using Amplex-Red (10-acetyl-3,7-dihydroxyphenoxazine; ADHP; Thermo Fisher Scientific, Waltham, MA, USA) as described by Fichman et al ...
-
bioRxiv - Genomics 2022Quote: ... sections were immunostained for acetyl-Histone H3 (Lys9) rabbit antibody (Ac-H3K9, MA5-11195, 1:400, Thermo Fisher Scientific Inc., Waltham, MA) and fluorescently labeled with goat anti-rabbit ...
-
bioRxiv - Molecular Biology 2024Quote: 0.5 × 106 cells from HL-60 were harvested by centrifugation and resuspended in PBS 200 μL with 10 μM 5-(and-6)-chloromethyl-2′,7′—containing Acetyl ester of dichlorodihydrofluorescein diacetate (H2 -DCF, Eugene, Molecular Probes, OR) and 0.4 μg/mL 12-O-tetradecanoylphorbol-13-acetate (TPA ...
-
bioRxiv - Cancer Biology 2024Quote: The generation of reactive oxygen species (ROS) was quantified with the fluorogenic probe CM- H2DCFDA (6-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate, acetyl ester) (Thermo Fisher Scientific). Cells were treated with inhibitors for 4h ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Systems Biology 2020Quote: ... Peptides from each individual case (n=400) and the GIS pooled standard (n=100) were labeled using the TMT 10-plex kit (ThermoFisher 90406). In each batch ...
-
bioRxiv - Cell Biology 2021Quote: ... 1299003– HSS120158 and siChe-1 b, cat. n. 1299003–HSS120159) or a control sequence (siControl, cat. n. 12935300) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: Drosophila heads (n=10) and thorax (n=5) were dissected and crushed in ice-cold LDS lysis buffer (NP0008, NuPAGE, Novex, Life Technologies) supplemented with reducing agent (NP0009 ...
-
bioRxiv - Genomics 2020Quote: ... Experiments were performed in 96-well optical reaction plates (P/N 4306737) with MicroAmp optical adhesive film (P/N 4311971) from Applied Biosystems. A master mix with total volume of 11 µL for each PCR run was prepared ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples (N=400) and the pooled global internal standards (GIS) (N=100) were labelled using the TMT 10-plex kit (ThermoFisher 90406) as previously described in (Johnson et al. ...
-
bioRxiv - Genomics 2022Quote: ... Peptides from each individual (n=400) and the GIS pooled standard (n=100) were labeled using the TMT 10-plex kit (ThermoFisher 90406). Peptide eluents were separated on a self-packed C18 (1.9 μm ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells were maintained at 37ºC and 5% CO2 in DMEM containing 10% FBS and 1% penicillin/streptomycin. The N protein plasmid pCAGGs-N (Plescia, David et al. 2021) was transfected using Lipofectamine™ 2000 (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... PCR products of confirmed G2 heterozygous (n = 48) and final ebony-null mutants (n = 30) were Sanger sequenced on an ABI 3730XL DNA Analyzer system (Applied Biosystems). Targeted genome modifications were inspected in a multiple sequence alignment produced by Geneious v.2023.0.2.
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were transfected with either pcAGGS-N-flag-pCav3.1N2209-4506 or the control vector pcAGGS-N-flag using Lipofectamine 2000 (ThermoFisher, Waltham, US). Following a 48-hour incubation at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Microbiology 2022Quote: ... the resulting DNA fragments were separated by loading 10 µl of PCR product onto a 1.5% agarose gel stained with ethidium bromide (Invitrogen, Thermo Fisher Scientific, Waltham, USA) in a 1 × Tris/acetate EDTA (TAE ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2020Quote: UMSCC47 and UPCI-SCC90 cells expressing Neo and Nrf2 cells were used to determine the extracellular H2O2 using 10-acetyl-3,7-dihydroxyphenoxazine (Amplex Red Hydrogen Peroxide Assay kit from Molecular Probes Inc., Eugene, OR) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2020Quote: ... Human brain samples classified into healthy (n=47) and AD (n=32) were processed by array (Affymetrix Human Gene 1.0 ST Array)53 ...