Labshake search
Citations for Thermo Fisher :
7351 - 7400 of 7824 citations for HER4 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Systems Biology 2022Quote: Adult human epidermal keratinocytes were cultured in EpiLife serum-free keratinocyte growth medium supplemented with Human Keratinocyte Growth Supplement (HKGS) and 100 units/mL Penicillin and 100 μg/mL Streptomycin (Thermo Fisher Scientific). Adult human dermal fibroblasts were cultured in Medium 106 supplemented with Low Serum Growth Supplement (LSGS ...
-
bioRxiv - Neuroscience 2022Quote: The expression level of 752 miRNAs was screened by real-time PCR with TaqMan Advanced miRNA Human A and B Cards (Applied Biosystems A31805). cDNAs were diluted 1:10 with 0.1X TE buffer ...
-
bioRxiv - Microbiology 2022Quote: ... ATCC TIB-202) or primary human monocytes (PHMs) were propagated in RPMI 1640 with L-glutamine and 25 mM HEPES buffer (Invitrogen, Carlsbad, CA), supplemented with 1 mM sodium pyruvate (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Cell-free plasma was analyzed using a human magnetic cytokine panel providing simultaneous measurement of 35 cytokines (Thermo Fisher Scientific, Waltham, MA). The assay was performed according to the manufacturer’s instructions with each subject sample performed in duplicate and then analyzed on a Luminex FLEXMAP 3D instrument.
-
bioRxiv - Bioengineering 2022Quote: ... WBCs were isolated from human whole blood and also stained with a live cell marker (10 μM CMTPX, Invitrogen™, Carlsbad, USA). Detailed methods for MCF-7 cell culture and staining of cancer cells and WBCs are provided in our previous works 24-26 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human bone marrow mesenchymal stem cells (hMSCs, RoosterBio, Maryland, USA) were cultured in alpha Minimal Eagle’s medium (α-MEM) (Gibco, Carlsbad, USA) with 10% FBS and 1% penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2022Quote: Male mouse neuroblastoma Neuro-2a (N2a; ATCC, CCL-131) and female human epithelial HeLa (ATCC, CCL-2) cells were maintained in MEM (Thermo Fisher Scientific), supplemented with 10% FCS ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed once and incubated with a PE-labelled goat anti-human IgG secondary antibody (Thermo Fisher Scientific 12-4998-92) at a final concentration of 2.5μg/mL of 30 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: Raw MS Data were searched against the human SwissProt protein database (Version November 2020) with Proteome Discoverer 2.4 (ThermoFisher Scientific, Bremen, Germany) using the following parameters ...
-
bioRxiv - Developmental Biology 2022Quote: Culture media consisted of LWRN conditioned media generated as previously described45,46 and combined with human basal media (Advanced DMEM/F12 (Gibco, Cat#12634-028); Glutamax 4 mM (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: MRC5 cells (human lung fibroblasts, ATCC® Cat# CCL-171TM, RRID:CVCL 0440) were maintained in MEM media (Cat# 11095080, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2021Quote: ... Immune mediator levels in COVID-19 patient plasma across different active and convalescent groups were measured with 24-plex Human ProcartaPlex™ (ThermoFisher Scientific). The kit analyte detection panel included brain-derived neurotrophic factor (BDNF) ...
-
bioRxiv - Microbiology 2021Quote: ... plates were washed three times and incubated for 30 minutes at room temperature with cross-absorbed goat anti-human IgG-horseradish peroxidase (HRP)-conjugated secondary antibody (ThermoFisher Scientific; A18811) diluted to a 1:2500 dilution in ELISA wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... containing 10 μg/ml DNase I (StemCell; #7469) and re-plated into 12-well plates coated with 10 μg/ml human bulk fibronectin (ThermoFisher Scientific; #3560) at a density of 750,000 cells/well ...
-
bioRxiv - Biochemistry 2021Quote: Resting CD4+ T cells were purified from bulk PBMCs by using Dynabeads™ Untouched™ Human CD4 T Cells Kit (ThermoFisher Scientific). Selected CD4+ T cells were activated by Dynabeads™ Human T-Activator CD3/CD28 kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and the corresponding light chain (human IgKappa, IgLambda) expression vectors respectively and produced in transiently expressed in Expi-CHO-S cells (Thermo Fisher, #A29133) at 37°C and 8% CO2 ...
-
bioRxiv - Microbiology 2021Quote: To facilitate the analyses of invasion assays, HeLa cells (human cervical carcinoma, ATCC® CCL-2™) were cultured in Dulbecco’s modified eagle medium (DMEM, Thermo Fisher) supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: Human HGSNAT codon-optimized cDNA Tordo (31) fused to a GFP (HGSNAT-GFP) was cloned into a pENTR1A vector (Invitrogen, 11813-011) and then transferred to a 3rd generation lentiviral vector plasmid (pLenti PGK Blast DEST (w524-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Commercially available ELISAs for quantitative detection of human total IgG were used according to manufacturer’s protocols (Thermo Fisher Scientific, Waltham, MA, U.S.A.). All plates were read in a microtiter plate reader at 450 nm and optical density values were used in statistical analyses.
-
bioRxiv - Cell Biology 2020Quote: ... 0.055 mM β-mercaptoethanol (#21985-023) and recombinant human full-length bFGF (#PHG0261) at 10 ng/ml (all reagents from Life Technologies).
-
bioRxiv - Microbiology 2021Quote: ... followed by one wash in a large volume of PBS and then incubation with Alexa647-coupled anti-human secondary antibody (Thermo Fisher Scientific) at 1:200 in 10% FCS in PBS ...
-
bioRxiv - Biochemistry 2020Quote: hTERT keratinocytes were cultured with Epilife media supplemented with human Keratinocyte Growth Supplement and Gentamicin/Amphotericin B 500X (Thermo Fisher Scientific, USA). Cells grown to passage 3 were treated for 24 hr with vehicle (DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... They were then incubated with 1:200 diluted Alexa Fluor 594 conjugated goat anti-human IgG secondary antibody (Invitrogen, Thermo Fisher Scientific) for 45 min at RT and subjected to flow cytometric analysis with a CytoFLEX flow cytometer (Beckman) ...
-
bioRxiv - Microbiology 2020Quote: ... and cultured in RPMI medium supplemented with 10% FBS and differentiated for 7 days with 20 ng/mL recombinant human Macrophage-Colony Stimulating Factor protein (M-CSF) (Thermo Fisher Scientific), and 100U/L of penicillin-streptomycin solution (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted and the whole transcriptome of ALDH+ and ALDH-populations was assessed using Affymetrix Whole-Transcript Human Gene 1.0 ST Array (Affymetrix, Thermo Fisher Scientific) (30) ...
-
bioRxiv - Immunology 2020Quote: Human peripheral blood mononuclear cells (PBMCs) from SARS-CoV-2 convalescent donors were stained with Live/Dead Fixable Aqua (Invitrogen; Thermo Scientific) in 100 μL final volume diluted 1:500 at room temperature (RT) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the corresponding light chain (human IgKappa, IgLambda) expression vectors respectively and produced in transiently transfected ExpiCHO-S cells (Thermo Fisher, #A29133) at 37°C and 8% CO2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Recovered nanovials were washed two times with washing buffer and sequentially labeled with streptavidin and biotin goat anti-human IgG Fc (Thermo Fisher, A18821) following standard procedures described above ...
-
bioRxiv - Cancer Biology 2021Quote: ... together with 0.5µg of a plasmid expressing the renilla luciferase under the control of the human β-actin promoter using Lipofectamine 3000 (ThermoFisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Human VAT and SAT biopsies (30-50g) were minced and digested with 3mg/mL type II collagenase solution (ThermoFisher Scientific Inc./Gibco) in HBSS containing calcium chloride ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum B11 line (Perrin et al., 2018) was maintained at 37° C in human RBCs in RPMI 1640 containing Albumax II (Thermo Fisher Scientific) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2022Quote: APEX2 coding sequence (56) with the FLAG epitope at the N-terminus optimized for expression in human cells was synthesized by Invitrogen (GeneArt service). For the transient expression ...
-
bioRxiv - Neuroscience 2022Quote: ... were placed in co-culture with astrocytes 24 h following purification and both cell types were maintained in human ESFM supplemented with B-27 (Thermo Fisher Scientific). Co-cultures were maintained for 24 h prior to experiments.
-
bioRxiv - Immunology 2022Quote: A human primary fibroblast line was maintained in Dulbecco’s Modified Eagle’s Medium with 10% heat inactivated FBS (Thermo Fisher Scientific, Gothenberg, Sweden), 10 U/ml Penicillin/Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... arrays were incubated for 1h30 with AF647-conjugated goat anti-human IgG antibodies (at 1 µg/ml in PBS; Thermo Fisher Scientific), and revealed using GenePix 4000B microarray scanner (Molecular Devices ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated 20 min at 4°C with AF647-conjugated goat anti-human IgG antibodies (1:1000 dilution; Thermo Fisher Scientific) and LIVE/DEAD Fixable Viability dye Aqua (1:1000 dilution ...
-
bioRxiv - Immunology 2022Quote: FLAG-DNAM-1-expressing human Treg cells were co-cultured in complete RPMI-1640 culture medium with 2 × 104 CellTrace Violet (Thermo Fisher Scientific)-labeled Tconv cells (freshly isolated from the same donor as that of the Treg cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... These plasma samples were diluted at least 2x or more (as required) and then were used to detect PTN by ELISA using commercial human PTN ELISA kits (ThermoFisher Scientific, EH370RB). CXCL5 ELISA from tumor lysates was performed using commercial kit (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... 99 base pair DNA sequences from genes selected for validation were amplified from human RNA using SuperScript IV One-STEP RT-PCR (Thermo Fisher Scientific), or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... The internalization of the ACE2-HA protein and anti-hACE2 mAbs was then evaluated by staining with goat anti-mouse Alexa Fluor™ 594 (to detect the HA-tagged hACE2) and/or goat anti-human Alexa Fluor™ 488 antibodies (to detect the hACE2 mAbs) (ThermoFisher Scientific). Images were captured using a DeltaVision OMX SR imaging system (GE Healthcare).
-
bioRxiv - Systems Biology 2020Quote: We cultured GM11169 human cardiac fibroblasts (Coriell, GM11169; XX donor) on tissue culture-treated dishes in DMEM w/Glutamax + 9% FBS (Life Technologies 16000044) + P/S.
-
bioRxiv - Molecular Biology 2019Quote: ... the miRIDIAN microRNA Mimic (catalog number CS-001030) and Inhibitor (catalog number IH-001030) Libraries (19.0, human microRNAs) were purchased from Dharmacon (Thermo Fisher Scientific Inc.). For the mimic screen ...
-
bioRxiv - Cancer Biology 2019Quote: ... labeled cDNA targets were generated with the Encore® Biotin Module (Nugen) and hybridized to a GeneChip® Human Transcriptome Array 2.0 (Affymetrix, Thermo Fisher) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cells were cultured for 14 days in a humified CO2 incubator at 37°C in complete culture medium with Dynabeads® Human T-Activator CD3/CD28 beads (ThermoFisher Scientific) (25µl/well ...
-
bioRxiv - Immunology 2019Quote: ... a 20X IL-26 human TaqMan® probe was used (Hs00218189_m1) with 2X TaqMan® Fast Advanced Master Mix (both from ThermoFisher Scientific). OSM and HEBGF cDNA quantification was performed with Roche ® hydrolysis probes (OSM ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA from human cytobrushes was also reverse transcribed to first strand cDNA using the SuperScript™ IV VILO™ Master Mix (11766050, Invitrogen). To quantify host inflammatory mediators’ transcripts (IL-6 ...
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with human PBMCs isolated from healthy donors that were fluorescently labeled with Cell Trace Violet (Invitrogen, Cat. Nr.: C34557) at an effector:target ratio of 20:1 ...
-
bioRxiv - Microbiology 2021Quote: Primary HFFF immortalised with human telomerase (HFFF-TERTs) (96) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific, Lutterworth, UK) supplemented with 10 % foetal bovine serum (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...