Labshake search
Citations for Thermo Fisher :
7101 - 7150 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked with PBS containing 3% bovine serum albumin (ThermoFisher) and 5% normal goat serum (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein was loaded on a 3-12% gel (Invitrogen BN10001B0X) and run using Invitrogen buffers (BN2002 ...
-
bioRxiv - Immunology 2024Quote: ... SKOV-3 cells were maintained in McCoy’s 5A media (Gibco) supplemented with 10% HI FBS and 1X Anti-Anti ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µL of Lipofectamine LTX (Thermo Fisher Scientific, Waltham, MA) was diluted in optiMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were diluted (1:3) using loading buffer (ThermoFisher), heat-denatured for 3 minutes at 95°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μg/ml anti-HA antibody (Invitrogen, Cat# 26183) for one hour and a half at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... and counted using a Countess 3 Automated Cell Counter (ThermoFisher). All lines were determined to be mycoplasma free using MycoAlert Detection Kit (Lonza).
-
bioRxiv - Immunology 2024Quote: ... on a QuantStudioTM 3 Real-Time PCR Instrument (Applied Biosystems). The following primers were used for qRT-PCR: Vcam1 forward primer 5’-AGTTGGGGATTCGGTTGTTCT-3’;Vcam1 reverse primer 5’-CCCCTCATTCCTTACCACCC-3’;C1qa forward primer 5’-AAAGGCAATCCAGGCAATATCA-3’;C1qa reverse primer 5’-TGGTTCTGGTATGGACTCTCC-3’;H2-eb1 forward primer 5’-GCGGAGAGTTGAGCCTACG-3’;H2-eb1 reverse primer 5’-CCAGGAGGTTGTGGTGTTCC-3’;Ccl8 forward primer 5’-TCTACGCAGTGCTTCTTTGCC-3’;Ccl8 reverse primer 5’-AAGGGGGATCTTCAGCTTTAGTA-3’;Il27 forward primer 5’-CTGTTGCTGCTACCCTTGCTT-3’;Il27 reverse primer 5’-CACTCCTGGCAATCGAGA-3’;Gapdh forward primer 5’-AGGTCGGTGTGAACGGATTTG-3’;Gapdh reverse primer 5’-TGTAGACCATGTAGTTGAGGTCA-3’.All data were normalized to Gapdh quantified in parallel amplification reactions.
-
bioRxiv - Immunology 2024Quote: Doxazosin (#77883-43-3, Thermo Fisher Scientific, Houston, TX, USA) an α1 antagonist ...
-
bioRxiv - Immunology 2024Quote: PCR was performed using the QuantStudio 3 system (Applied Biosystems), with Advanced qPCR Mastermix (Wisent ...
-
bioRxiv - Immunology 2024Quote: ... Doxazosin (#77883-43-3, Thermo Fisher Scientific, Houston, TX, USA), and/or Atipamezole (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2024Quote: ... endogenous peroxidase was quenched in 3% hydrogen peroxide (Fisher Scientific) for 30 min at room temperature prior to antigen retrieval ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by 3 washes in DPBS (Thermo Scientific, Waltham, MA) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Plant Biology 2019Quote: Developing gemma cups located within 3 mm from an apical notch of 3-week-old thalli were manually dissected and immediately immersed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA). For the control ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: 3′-RACE was used to determine the length of the mRNA 3′UTRs using the 3′RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Yeast total RNA used for steady-state and half-life northern blots was used to generate cDNA using SuperScript™II RT (Thermo Fisher Scientific ...
-
Diurnal regulation of SOS Pathway and Sodium Excretion Underlying Salinity Tolerance of Vigna marinabioRxiv - Plant Biology 2024Quote: ... From the extracted RNA we prepared libraries for 3’mRNA-seq with Collibri 3’mRNA Library Preparation Kit for Illumina Systems (Thermo Fisher Scientific K.K., Tokyo, Japan). The prepared libraries were sequenced with Hiseq4000 as a customer service of GeneBay Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cancer Biology 2021Quote: ... was validated by STR analysis using AmpFLSTR™ Identifiler™ Plus PCR Amplification Kit (Cat n:4486467, ThermoFisher Scientific) using the provided protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... ovaries from randomly cycling female mice (FVB/N, 6 weeks old) were collected and incubated in 0.25% Trypsin/PBS (Invitrogen) (37 °C ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... over the course of 28 days and healthy controls (n = 37) and hybridized onto an HU133 Plus 2.0 GeneChip (Affymetrix) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... GFP-N was immunoprecipitated from two independent HEK293 cell pellets using 5μg of anti-GFP antibody (Life Technologies G10362). A total of 2% input material was obtained for size-matched control libraries (SMI ...
-
bioRxiv - Neuroscience 2019Quote: ... LUHMES neuroblastoma cells (ATCC Cat# CRL-2927) were maintained DMEM/F12 (ATCC) supplemented with N-2 supplement (1%; Invitrogen) and human recombinant basic fibroblast growth factor (40 ng/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... Cortical hemispheres were dissected and homogenized in ice-cold homogenization buffer (N-PER Neuronal Protein Extraction Reagent (ThermoFisher Scientific) with cOmplete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... GenBank accession number BC057894.1) with an N-terminal hemagglutinin (HA) tag were reverse transcribed with SuperScript III Reverse Transcriptase (Invitrogen) and PCR-amplified using Phusion high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Bioengineering 2021Quote: Each sample (n=5) was placed in a 2 mL centrifuge tube containing 320 μL of collagenase II (Gibco, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biochemistry 2021Quote: N-terminal GST-tagged MBNL1 (amino acids 1-260)59 was recombinantly expressed using BL21 Star (DE3) cells (Invitrogen) and protein expression induced using 0.5 mM IPTG at an OD600 = 0.6-0.7 for 2 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... NosRcaΔC and NosRca-IFmut was labelled at the N terminus with the fluorophore Alexa Fluor 405 NHS ester (ThermoFisher) (∼2.2 ...
-
bioRxiv - Neuroscience 2021Quote: DRGN and retinal cells were washed with PBS and total RNA (n = 6-9 wells/treatment) was extracted using Trizol reagent according to the manufacturer’s instructions (Invitrogen). Appropriate primers were used to validate each gene of interest using the specific primers (Table 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor® 555 goat anti rabbit IgG (Cat. N° A21429) was obtained from Life Technologies (Carlsbad, CA, USA), Alexa Fluor® 488 Goat Anti-Mouse IgG (Cat ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Neuroscience 2020Quote: Mouse midbrains (n = 5-6 per group per age) were collected and RNA was isolated using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... over the course of 28 days and healthy controls (n = 37) and hybridized onto an HU133 Plus 2.0 GeneChip (Affymetrix) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Tyr-nitration of MSD2 was detected after SDS-PAGE with anti-Nitrotyrosine primary antibody (Invitrogen, cat. n. A-21285) diluted to 1:3,000 in TBST with 3% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and the N-terminus of the construct was attached to a biotinylated DNA-coated paramagnetic bead (2.8 μm diameter, Invitrogen) via a biotin-neutravidin interaction ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Biophysics 2020Quote: A1-LCD was fluorescently labeled on the N-terminus using Alexa Fluor® 488 NHS ester fluorescent dye (ThermoFisher) to label the primary amines of proteins ...