Labshake search
Citations for Thermo Fisher :
7001 - 7050 of 9391 citations for Mumps Virus Nucleoprotein Strain L Zagreb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were stained with Alexa-Fluor 647 anti-rabbit (H+L) secondary antibody (ThermoFisher Scientific #A-31571) for 45 min at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were incubated with secondary antibodies (Alexa-conjugated IgG H+L series, Thermofisher, diluted to 1:500) and 1 μg/mL DAPI (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cells were grown on tissue-culture treated plates in DMEM containing high glucose and L-glutamine (Gibco) and supplemented with 1x penicillin/streptomycin (Gibco ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with methyl methanethiosulfonate (MMTS, 1 mol/L, Cat. # 23011; Thermo Fisher Scientific, Dreieich, Germany) at 50°C for 30 minutes to block free thiols ...
-
bioRxiv - Genomics 2024Quote: ... 2 mM L-glutamine (PAN-P04-80100) and 1x MEM non-essential amino acid (Gibco 11140-35) solution ...
-
bioRxiv - Immunology 2024Quote: ... followed by anti-IgG (H+L) highly Cross-Adsorbed secondary antibody (Alexa Fluor 555) (Thermo Fisher Scientific). After one hr of incubation in the dark ...
-
bioRxiv - Cell Biology 2024Quote: ... were kept in Dulbecco’s modified Eagle’s medium (with 4.5 g/l D‐glucose, HyClone) with 10% fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were stained with 1 μM LysoSensor Yellow /Blue DND-160 (Thermo Fisher Scientific, L-7545) for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and goat anti-rabbit IgG (H + L) highly cross-adsorbed secondary antibody Alexa Fluor 594 (Invitrogen/ThermoFisher). Nuclei were stained with DAPI before mounting (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... and Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody Alexa Fluor 647 (Thermo Fisher Scientific) to assess CM purity as described by Zhang et al.39 Flow cytometry was performed on a Cytoflex Flow Cytometer (Beckman Coulter ...
-
bioRxiv - Biophysics 2021Quote: ... in the presence of 1/5 biotin-16-dUTP (JenaBioscience, NU-803-BIO16-L) to dTTP (ThermoFisher, 10520651). The PCR was done with primer CD21 (GACCGAGATAGGGTTGAGTG ...
-
bioRxiv - Biophysics 2019Quote: ... in minimal media (1% glycerol, 100 mM potassium phosphate pH 6.0, 0.4 mg L-1 biotin, 1X YNB from Invitrogen) supplemented with 1 mg mL-1 zeocin and cultured in shaker flask for 2 days at 29°C ...
-
bioRxiv - Biophysics 2020Quote: ... MDA-MB-453 cells were purchased from ATCC (ATCC HTB-131) and grown in L-15 (Life Technologies) supplemented with 10% FBS and 1% Pen-Strep without CO2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The secondary antibodies used were Goat anti-Mouse IgG (H+L) Alexa Fluor Plus 488 (# A32723, Thermo Fisher), Donkey anti-Rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2020Quote: ... a goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody Alexa Fluor 647 (#A21240, Invitrogen, USA); for flow cytometry analysis – an anti-Measles antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... S2-CP8 cell were transfected with ASOs at 10 nmol/L using RNAiMAX (Life Technologies/Thermo Fisher Scientific) in antibiotics-free medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... S2-CP8 cell were transfected with ASOs at 10 nmol/L using RNAiMAX (Life Technologies/Thermo Fisher Scientific) in antibiotics-free medium ...
-
bioRxiv - Cell Biology 2020Quote: ... The growth media was replaced with 10% FBS and 1% Pen/Strep supplemented Leibovitz’s L-15 medium (Invitrogen), 2h before the start of imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... Donkey anti-rabbit IgG (H+L) Alexa Fluor 488 (Thermo Fisher; Cat# A-21206; used at 1:250), Donkey antimouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... Donkey Anti-rat IgG (H+L) Alexa Fluor 488 (Thermo Fisher; Cat# A-21208; used at 1:250), and Goat anti-mouse IgM Antibody Alexa Fluor 488 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Donkey anti-rabbit IgG (H+L) Alexa Fluor 555 (Thermo Fisher; Cat# A-31572; used at 1:250), Donkey anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... adult worms were picked into a drop of M9 media on poly-l-lysine coated slides (Fisher scientific), cut in half to release oocytes ...
-
bioRxiv - Immunology 2021Quote: ... Pen-Strep-Glutamine (10.000 U/ml penicillin, 10.000 μg/ml streptomycin, 29.2 mg/ml L-glutamine (Life Technologies)) and 50 μM β-mercaptoethanol (Sigma)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and probed with goat anti-rabbit IgG (H+L) horse radish peroxidase conjugate (Life Technologies, Thermo Fisher Sciences), diluted 1:5,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and probed with goat anti-rabbit IgG (H+L) horse radish peroxidase conjugate (Life Technologies, Thermo Fisher Sciences), diluted 1:5,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were double-stained with live cell dyes Lysotracker Red DND-99 (Molecular Probes Cat. No. L-7528) and Mitotracker Deep Red FM (Molecular Probes Cat ...
-
bioRxiv - Developmental Biology 2020Quote: ... Alexa Fluor 546-conjugated goat anti-rat IgG (H+L) antibody (Thermo Fisher Scientific, #A11081, 1:1000 dilution), Alexa Fluor 647-conjugated goat anti-rabbit IgG (H+L ...
-
bioRxiv - Developmental Biology 2021Quote: ... The secondary antibodies were: Alexa Fluor 488 Goat anti-Rabbit IgG (H+L) (Thermo Fisher Scientific, A-11008), Alexa Fluor 555 Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2020Quote: ... The end-repaired chromatin was transferred to 665 μl of ligation mix (1.8% Triton-X 100, 0.18 mg BSA, 1.8× T4 DNA Ligase Buffer (Invitrogen, 46300018) and 5 μl of T4 DNA ligase (invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were cultured in complete RPMI media (RPMI 1640 plus L-glutamine and 25 mM HEPES media (Gibco RPMI 1640 Medium ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 10% heat-inactivated fetal bovine serum and penicillin (0.2 U/ml)/streptomycin (0.2 μg/ml)/L-glutamine (0.2 μg/ml) (Gibco, USA). The 772-bp and 267-bp fragment of FGF5 indel region were cloned into the pGL4.23 vector (Promege ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Assay was carried out with phenol red free DMEM supplemented with 4 mM L-glutamine (Thermo Fisher Scientific). Three hour before the assay ...
-
bioRxiv - Cancer Biology 2020Quote: ... HepG2 cells were grown in Dulbecco’s Modified Eagle Media (DMEM) containing 1 g/L glucose (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells grown in the first chamber were transfected with fluorescent Cy3-miR (10 nmol/L, Ambion, AM17120) and washed several times before connecting the chamber to the other two flow chambers in tandem ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... as outlined in Knapman 2013.18 Cells from a 90-100% confluent 75mm2 flask were resuspended in Leibovitz’s L-15 Medium (Gibco) supplemented with 1% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Rabbit anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody with Alexa Fluor 594 (A27016) and DAPI (Invitrogen).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and goat anti-mouse IgG (H&L) Alex FluorR 488 conjugate (Thermo Fisher Scientific; 1 in 2000 IF) were used in immunofluorescence imaging.
-
bioRxiv - Neuroscience 2019Quote: ... 0.5 μl of DiI (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate, 2.5 mg/mL in dimethyl sulfoxide, Thermo Fisher Scientific) were injected into the stratum moleculare of the dentate gyrus of the hippocampal filed using a motorized microinjector (Stoelting ...
-
bioRxiv - Genetics 2021Quote: ... and goat anti-mouse IgG (H+L) Alexa Flour 488 (Thermo Fisher Scientific, A-32723; 1:500 dilution) secondary antibodies at room temperature for 2 h ...
-
bioRxiv - Immunology 2019Quote: ... Control comparisons were performed using RPMI 1640 medium with L-glutamine and phenol red (Thermo Fisher; Waltham, MA), or 1X calcium-magnesium-free PBS (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... As secondary antibodies goat anti-rabbit IgG (H+L) Alexa Fluor 488 (A11034, Thermo Fisher, 1:400 dilution) and goat anti-mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were seeded on poly-L-lysine hydrobromide-coated six-well culture plates in Neurobasal Medium (NBM, GIBCO) supplemented with B27 ...
-
bioRxiv - Biophysics 2021Quote: ... and the medium was changed to Leibovitz’s L-15 medium without phenol red (21083027 Thermo Fisher Scientific, USA) supplemented with 1% Pen/Strep and 1% GlutaMAX ...
-
bioRxiv - Biochemistry 2020Quote: ... The secondary antibodies used were goat anti-mouse IgG (H+L) antibody conjugated to HRP (Invitrogen, catalog # 31430) and goat anti-rabbit IgG (H+L ...
-
bioRxiv - Bioengineering 2021Quote: ... or Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 568 (Thermofisher, A-11031) were diluted 1:200 in PBS and incubated with the cells for 4 hours at 4°C in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... or Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 568 (Thermofisher, A-11031) were diluted 1:200 in PBS and incubated with the cells for 4 hours at 4°C in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... or Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 568 (Thermofisher, A-11031) were diluted 1:200 in PBS and incubated with the cells for 4 hours at 4°C in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... or Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 568 (Thermofisher, A-11031) were diluted 1:200 in PBS and incubated with the cells for 4 hours at 4°C in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... The proteins were detected with horse radish peroxidase (HRP)-conjugated rabbit anti-goat IgG (H+L) (R21459, Invitrogen), goat anti-mouse IgG ...
-
bioRxiv - Bioengineering 2020Quote: ... and centrifuged at 200G for 10 min The pellet was resuspended in DMEM containing 1g/L glucose (Gibco) supplemented with 19% M-199 medium (Sigma) ...