Labshake search
Citations for Thermo Fisher :
651 - 700 of 3080 citations for RAP1GAP siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Silencer Select siRNAs were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA transfections were performed with Lipofectamine 2000 (Invitrogen) using SilencerSelect siRNAs (Ambion ...
-
bioRxiv - Neuroscience 2023Quote: ... Silencer® Negative Control siRNA #1 (Ambion, AM4611) was used as the control ...
-
bioRxiv - Genomics 2024Quote: ... A non-targeting siRNA (cat. no. AM4611, Ambion) served as an experimental control ...
-
bioRxiv - Genomics 2024Quote: ... FAK and p130Cas siRNAs were obtained from Ambion: FAK siRNA #1 (ID ...
-
bioRxiv - Cell Biology 2024Quote: For TMUB1 downregulation stealth siRNA from Thermo Fisher were used at 100 nM final concentration ...
-
bioRxiv - Cell Biology 2023Quote: All siRNA transfections were performed using RNAiMAX (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... siRNAs (20nM) were transfected using Lipofectamine RNAiMax (Invitrogen). For detailed protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HIF1A siRNA (Cat# 4427037, Ambion Inc., USA) were prepared and transfected to ARPE-19 cells according to the manufacturer’s instructions (Lipofectamine RNAiMAX reagent packages ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs were diluted in OptiMEM medium (Gibco, 31985) and mixed with an appropriate volume of INTERFERin ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Kif22/Kid siRNA (Ambion, #Cat 4392420, ID:s7911), human WAPL ON-TARGET plus SMART pool siRNA (J-026287-10-0010 ...
-
bioRxiv - Molecular Biology 2023Quote: ... compared to non-targeting control siRNA#2 (Thermofisher). Screen z’ averaged 0.7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Silencer Negative Control siRNA #1 (Thermo Fisher Scientific) was used as negative control ...
-
bioRxiv - Cancer Biology 2023Quote: Silencer Select siRNAs were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 siRNA (Thermo Fisher Scientific, Cat. No. 4390844) served as a control ...
-
bioRxiv - Microbiology 2024Quote: ... The silencer select negative control-1 siRNA (Ambion) was used as negative control ...
-
bioRxiv - Immunology 2024Quote: ... and the following siRNAs were purchased from Invitrogen and used for knockdown experiments ...
-
bioRxiv - Genomics 2024Quote: ... siRNA TRESLIN (Life Technologies, (Kumagai et al. 2010), and siControl (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: siRNA transfections were performed using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and siRNA were dissolved in OptiMEM medium (Gibco) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or siRNAs targeted against BICD1 (Invitrogen, ID: 147217) and BICD2 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... or siRNAs directed against BICD1 (Invitrogen, ID: 147217) or BICD2 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... siSilencer (Silencer® Negative Control #1 siRNA, Ambion); siGFP (GFP-22 siRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... three siRNAs targeting each were purchased from Ambion (Silencer Select ...
-
bioRxiv - Microbiology 2024Quote: ... The silencer select-negative control-1 siRNA (Ambion) was used as negative control ...
-
bioRxiv - Cell Biology 2020Quote: Small interfering RNAs (siRNAs) specifically targeting human CD44 (siRNA IDs s2681 and s2682) were obtained from Life Technologies (Carlsbad, CA, USA). DPSCs (1×105 per well ...
-
bioRxiv - Immunology 2022Quote: ... and 5 nM of either AhR-specific “SilencerSelect” siRNA (s1199) or nonsilencing control siRNA (4390844) purchased from Life Technologies (Carlsbad, CA). After 24 h of incubation with the siRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... All siRNAs and appropriate NT siRNAs (siGENOME Non-targeting siRNA Pool #1 and ON-TARGETplus Non-targeting Control Pool; Dharmacon) were purchased from Life Technologies. ARPE-19 cells were grown to ∼80% confluence and then transfected with siRNA using Lipofectamine® RNAiMAX Reagent (Life Technologies) ...
-
bioRxiv - Cancer Biology 2019Quote: ... BCL2L11 (Bim) siRNA SMARTpool was from Dharmacon (L-004383-00-0005) and BAK siRNA was obtained from Ambion (Life Technologies 4457298).
-
bioRxiv - Cell Biology 2019Quote: ... mDia1 siRNA (J-010347-070005) and control GAPDH (D-001140-01-05) siRNA constructs were purchased from Thermo Scientific (Waltham, MA), and mDia2 shRNA and control pGFPVRS from Origene (Rockville ...
-
bioRxiv - Molecular Biology 2021Quote: ... media with 100 nM siRNA (rat siGabarapl1; siGENOME SMARTpool, Dharmacon; Figure S4a) vs non-targeting scrambled siRNA with Lipofectamine RNAiMAX (Life Technologies) for 16 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... Supplemental Table 4) of short interfering RNAs (siRNAs) or non-targeting scrambled siRNA/siLuciferase (IDT Korea) were delivered with Lipofectamine 3000 (Life Technologies) or DharmaFECT (Dharmacon ...
-
bioRxiv - Cell Biology 2021Quote: ... each well was transfected the day after seeding with 100 pmol dicersubstrate TNKS siRNA (27mer dsiRNA, Integrated DNA Technologies) or 21mer silencer select TNKS siRNA (ID s75314, ThermoFisher Scientific) using 7.6 μl X-tremeGENE (Roche Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... cat# M-081156-01-0005) smartpool siGENOME siRNAs, and MKL1 (gene ID:315151, cat# J-081405-08) ON-TARGETplus siRNA were from Dharmacon (Thermo Scientific). MTLn3 cells were transfected with siRNAs using Oligofectamine (Life Technologies ...
-
bioRxiv - Systems Biology 2022Quote: OP9 cells were transfected with the respective siRNA or control siRNA 24 hours before the start of an experiment by reverse transfection using Lipofectamine RNAiMax (Invitrogen #13778150), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: 462 unique siRNAs targeting each of 156 genes were coated in 96-well plates (silencer Custom siRNA library, Ambion, Austin, USA). 6xE2F-luciferase reporter ...
-
bioRxiv - Neuroscience 2020Quote: ... The following three PINK1 siRNAs were used at a final concentration of 60 pmol/ml each: siRNA PINK1 HSS127945/127946/185707 (Life Technologies). To identify transfected cells by fluorescence microscopy ...
-
bioRxiv - Immunology 2020Quote: ... Huh7:HLA-C*0102 cells were transfected using Jetprime (Polyplus, UK) reagent with siRNA control or siRNA targeting XP01 (ThermoFisher Scientific). XP01 expression was analyzed by immunoblotting after 48 hours and cells were used in cytotoxicity and degranulation assays 48 hours post transfection.
-
bioRxiv - Cell Biology 2019Quote: Murine cardiac fibroblasts were grown to 80% confluence and transfected with 10 nM Piezo1-specific Silencer Select Pre-Designed siRNA (4390771, siRNA ID: s107968, Life Technologies) or Silencer Select Negative Control No ...
-
bioRxiv - Cancer Biology 2019Quote: ... SRSF2 3’ UTR-siRNA antisense, UAGGUCAAUACUGCCAAUU) or a non-specific siRNA (CTRL sense, AAGGUCCGGCUCCCCCAAAUG; CTRL antisense, CAUUUGGGGGAGCCGGACCUU) were synthesized by Life Technologies. siRNAs were transfected into MCF7 cells at a concentration of 30 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2020Quote: ... siRNA-mediated knockdown was performed by transfecting Caco-2 cells with 20 nM amounts of siRNA and Lipofectamine RNAiMAX (Thermo Fisher). Knockdown efficiency was assessed by Western blot analysis at 72h post transfection.
-
bioRxiv - Immunology 2021Quote: Two different siRNA for thymidylate synthase (TYMS silencer select s14538, s14539) and one control siRNA (silencer select Negative Control #1) (Ambion, Life Technologies) were used at 100 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Larger scale knockdown samples were produced by reverse transfecting 5 million cells with 35 μL of transfection reagent in 10 cm plates. The control siRNA (siNC; “Silencer® Select Negative Control No. 1 siRNA”) was purchased from Invitrogen™ (cat ...
-
bioRxiv - Molecular Biology 2022Quote: C2C12 cells were plated onto 6-well plates at a 2 x105 density and 24 h later transfected with either negative control siRNA (Negative Control No.1 siRNA, Life Technologies) or custom siRNAs targeting S1P (Silencer Select siRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... C2C12 cells were plated onto 24-well Seahorse XF24 cell culture microplates at a 8,000 cell density and 24 h later co-transfected with either negative control siRNA (Negative Control No.1 siRNA, Life Technologies) with empty vector (pCMV6-Entry ...
-
bioRxiv - Immunology 2022Quote: ... The cells were transfected with 75 nmol/L siRNA targeting TLR2 (GenePharma, China) or siRNA negative control using 0.75 μl of Lipofectamin 3000 (ThermoFisher Scientific, USA). After 72 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and siRNA non-targeting control siRNA pools (Dharmacon D-001810-10-05) were mixed with Lipofectamine RNAiMax (5 µL, ThermoFisher 13778075) in a total of 200 µL Optimem (Life Technologies 31985-062 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with either scrambled (non-targeting #1) siRNA or Septin9 siRNA (J-048947-11-0050 ONTARGETplus) with Lipofectamine-iMAX (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.