Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The resolved samples were run on either NuPAGE 3–8% Tris-acetate or NuPAGE 12% Bis-Tris protein gels (Thermo Fisher Scientific) with the appropriate running buffer ...
-
bioRxiv - Bioengineering 2023Quote: The mouse brain endothelial cell line bEnd.3 was purchased from ATCC (cat# CRL-2299) and cultured in DMEM/F-12 medium (Gibco, cat# 11320033) supplemented with 10% FBS (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 12 mM MgCl2 (ThermoFisher), 10 mM dithiothreitol (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... 12 mM EDTA (Invitrogen) in DMEM:F12 (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... Ham’s F-12 (ThermoFisher), 10% FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DMEM/F-12 (Invitrogen), supplemented with 10 ng/mL bFGF (Stemgent) ...
-
bioRxiv - Developmental Biology 2022Quote: ... clone MTn-12 (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... #12 samples (ThermoFisher Scientific). For the E ...
-
bioRxiv - Genomics 2022Quote: ... 12 mM MgCl2 (ThermoFisher), 1% IGEPAL CA-630 (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: DMEM/F-12 (Gibco) supplemented with 20% Heat-inactivated FBS (R&D Systems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... DMEM/F-12 (Gibco), B-27 (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 12 mM HEPES (ThermoFisher), 5% FBS (GIBCO) ...
-
bioRxiv - Bioengineering 2023Quote: ... DMEM/F-12 (Gibco) was supplemented with Human Serum Albumin (Alburex 20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-12% (Thermo Fisher) with Bolt MES SDS Running Buffer (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... and F-12 (Gibco) at 1:1 ratio ...
-
bioRxiv - Physiology 2019Quote: ... Hearts were immersed for one day in a chemical mixture obtained by mixing 25 wt% urea (U16–3, Fisher Scientific Hampton, NH, USA), 25 wt% N,N,N0,N0-tetrakis(2-hydroxypropyl ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... Each piece was incubated overnight in a Netwell™ insert in a Falcon® 12-well plate filled with Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12, Thermo Fisher Scientific). The media was supplemented with 2% FBS (fetal bovine serum ...
-
bioRxiv - Cell Biology 2021Quote: ... from Instituto de Ciências Biomédicas-USP) were cultured in Dulbecco Modified Eagle’s/ HAM F-12 medium (1:1, DMEM/F-12, Gibco, #12-500-062), supplemented with 5% horse serum (Gibco # 16050-122) ...
-
bioRxiv - Microbiology 2022Quote: ... MLE-12 cells were maintained in Dulbecco′s Modified Eagle′s Medium/Nutrient Mixture F-12 Ham (DMEM/F-12; Gibco, US) medium containing 2% fetal bovine serum (FBS ...
-
bioRxiv - Zoology 2021Quote: ... and with NanoDrop One (ThermoFisher) with target OD 260/280 and OD 260/230 ratios of 1.8 and 2.0-2.2 ...
-
bioRxiv - Microbiology 2021Quote: ... One-step Ultra TMB (ThermoFisher) was then used for detection ...
-
bioRxiv - Immunology 2021Quote: ... one labeled with AlexaFluor647 (Invitrogen), were used in this panel in order to increase specificity of the detection of SARS-CoV-2-specific B cells ...
-
bioRxiv - Immunology 2021Quote: ... one labeled with AlexaFluor488 (Invitrogen), one labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... and NanoDrop One (Thermo Fisher).
-
bioRxiv - Genomics 2023Quote: ... spectrophotometric (Nanodrop One, Fisher Scientific) determination of purity ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli One Shot TOP10 (Invitrogen) were transformed with the resulting vector ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Evolutionary Biology 2020Quote: ISH and dFISH were performed as previously described (3, 7, 62) with addition of T1 RNAse treatment (2 u/µl, Thermo Fisher Scientific, Waltham, MA, USA) after probe washing in embryos older than 4 dpf to reduce background staining ...
-
bioRxiv - Immunology 2021Quote: ... To obtain Mfs purified monocytes were plated on 24 well plates 3 × 105 cells/well and cultured for 7 days in Macrophage-SFM (Gibco, Life Technologies, Grand Island, NY, USA) with recombinant human GM-CSF (Miltenyi Biotech ...
-
bioRxiv - Cell Biology 2021Quote: Transfection procedure of pre-miR-145 in Calu-3 cells was performed in 12-well plates using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, Thermo Fischer Scientific) accordingly to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted RNA from each positive sample was used as template to synthesize cDNA using primer MBTuni-12 (5’-ACG CGT GAT CAG CRA AAG CAG G-3’) and Superscript III First Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA, USA), following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and proteins were loaded at equal Chl content in the native gel (NativePAGE™ 3 to 12%, Bis-Tris, 1.0 mm, Mini Protein Gel, 10-well from ThermoFisher catalog number BN1001BOX). Prior to loading the samples were supplemented with sodium deoxycholate (final concentration 0.3%) ...
-
bioRxiv - Biophysics 2021Quote: ... Protein samples (12 μL) were mixed with 3 μL 5 M DTT and 5 μL 4x NuPAGE™ LDS sample buffer (Thermo Fisher Scientific) and incubated (95 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples (10 µg) were then added to each well and protein complexes were separated on 3-12% NativePAGE gels (Thermo Fisher Scientific, BN1003BOX). Proteins were transferred to PVDF membranes and probed with specific antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 105 HCT116 cells were reverse-tranfected with 20nM of siRNA siCTRL or siSFPQ-3’UTR(Horizon discovery) in 12-well plates using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, #11668019) diluted in Opti-MEM transfection medium according to the manufacturer’s instructions and incubated for 24 hours at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was then centrifuged at 14000 RCF for 3 minutes and the supernatant transferred to HPLC vials (Thermo Fisher Scientific; C4000-12) and sealed with a cap (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Immunology 2020Quote: ... The sorted germinal centre B cells (7-AAD−/B220+/GL-7+/Fas+) were digested with Proteinase K (Invitrogen) at 55°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 110 nm ultrathin cryosections were collected on 7×7 mm silicon wafers with fluorescent beads (PS-Speck, ThermoFisher). Light microscopy images were acquired with a widefield microscope ...
-
bioRxiv - Cell Biology 2020Quote: ... using the ViiAtm 7 platform (Applied Biosystems). Relative quantification was conducted by either SYBRgreen fluorescent dye (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 kDa cut-off (Thermo Scientific, #89890). The protein concentration was adjusted to 0.5 mg/ml in CD buffer (250 μL) ...
-
bioRxiv - Genomics 2020Quote: ... 7 mM MgCl2 (Ambion, Cat. No. AM9530G), 10% N,N-dimethylformamide (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... on the ViiA 7 system (Applied Biosystems). PCR of CD19 was used for normalization ...
-
bioRxiv - Immunology 2022Quote: ... on the ViiA 7 system (Applied Biosystems) as described (62 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 µL HinFI (10U/µL, Thermo Scientific)) per 70 µL of cDNA and digested at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... and a QuantStudio 7 Flex (Life Technologies) instrument ...