Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Microbiology 2023Quote: ... N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64) (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (9) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples (n = 3 technical replicates, each condition) were sorted with an Attune NxT flow cytometer (Thermo Fisher) and the DNA content was analyzed for the percent of cells in G1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead M270 amine (Invitrogen), DynaBead MyOne carboxylic acid (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... siPORT Amine (Invitrogen; #AM4502) was used as the transfection reagent ...
-
bioRxiv - Physiology 2023Quote: EAT (occluded and non-occluded tissue pooled) from exercise-trained (n=4) and sedentary (n=3) female pigs had total RNA extracted with TRIzol® (Thermofisher Scientific, Waltham, MA). Total RNA was quantified (Nanodrop 3300 ...
-
bioRxiv - Neuroscience 2019Quote: ... They were then washed 3 times with PBS and incubated for 1h at room temperature in secondary antibody (1:1000; ThermoFisher, Cambridge, MA; R37117). They were then washed once with PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Biochemistry 2021Quote: For MQAE (N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (ThermoFisher) assays U87 cells were seeded into dark 96-well microtiter flat-bottom plates at 4 × 104 cells·well-1 in 100 µL volumes DMEM media supplemented with 10% FBS and 1% Penicillin/Streptomycin and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed 3×5 min in PBS and incubated for 2 h with an Alexa Fluor® Plus 555-conjugated secondary antibody (Invitrogen A32816) diluted in the blocking solution ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Genomics 2021Quote: ... The embryoid medium was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Antibiotic-Antimycotic (Thermo Fisher Scientific; Cat. No. 15240062), 55 mM 2-mercaptoethanol (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-6 dpf larval zebrafish were anesthetized using 0.2 mg/mL Tricaine-S (Fisher Scientific, NC0872873) solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Microbiology 2021Quote: ... 1,2-Bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM, Invitrogen), calcium Ionophore A23187 (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Genomics 2023Quote: ... and 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, Gibco 15630080), and incubated at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were blocked for 1h with 2% I-Block (Thermo Fisher) prior to immuno-detection with mouse anti-GFP (UC Davis/NIH Neuromab Facility ...