Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... they were dissociated with 0.5 mM EDTA in DPBS and split every 4-5 days at a ratio 1:8-1:12 using Revitacell Supplement (Gibco). Fibroblasts and early passage iPSCs were cultured at 37°C in 5% CO2 and frozen at passage 4-5.
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 1-2 x 107 cells were incubated in 4 µM PBS-diluted CFSE (Invitrogen) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... for 1 h at 4°C.The DynaMag™-2 magnetic rack (Thermo Fisher Scientific) was used for flow-through removal and washing ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... protoplasts were resuspended in lysis buffer (45mM magnesium chloride, 30mM sodium citrate, 20mM MOPS, 0.5% triton, 2% 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific), pH 7 ...
-
bioRxiv - Immunology 2020Quote: ... Serial frozen sections (6 μm in thickness) were cut on a cryostat and counterstained with DAPI (4′,6-Diamidine-2′-phenylindole; Thermo Fisher Scientific). The number of beads in the SED from 3-4 sections of two Peyer’s Patches per mouse (n=3–4 mice/group ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside in DMSO (0.1-1mM, AICAR, Fisher Scientific), or isoproterenol (5-25µM ...
-
bioRxiv - Plant Biology 2022Quote: ... A second round of reverse transcription was initiated with the addition of 4 µL of reverse transcription mix (4:2:1:1 of First Strand Buffer, 0.1 M DTT, RNaseOUT, SuperScript II; ThermoFisher Scientific) to each sample then incubated at 25□ for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI 1640 containing 2 μM calcein AM and 4 μM EthD-1 along with 1 mg/mL DAPI (ThermoFisher, 62248) was added to the 384-deep well plate (80 μL/well) ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibodies solution ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibody solution ...
-
bioRxiv - Immunology 2023Quote: ... Invitrogen E-Gel EX Agarose Gels 4%, and DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, D1306) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... 20 ng ml-1 GM-CSF (Biozym) or X38-Ag8 supernatant (1%) and from day 5 on additionally with 10 ng ml-1 IL-4 (Life technologies). At day 7 ...
-
bioRxiv - Genomics 2023Quote: ... plugs were washed 4 times in 1×Wash Buffer (BNG) and 5 times in 1× TE Buffer (ThermoFisher Scientific, Waltham, MA). Then ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in PBS with 30nM of 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). In each tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) for 5 min ...
-
Single-cell protein analysis reveals metastable states during the transition to a sensory organ fatebioRxiv - Developmental Biology 2021Quote: ... Then they were stained with 0.5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific), and mounted in Vectashield (Vector Labs) ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Microbiology 2021Quote: ... and stained with 200 μl of 1.0 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) diluted in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were counterstained using 5μg/ml of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; D1306, Invitrogen) added during secondary antibody incubation.
-
bioRxiv - Cancer Biology 2021Quote: ... : DAPI Buffer (106mM MgCl2, 50 µg/mL 4’, 6-diamidino-2-phenylindole (DAPI, Invitrogen, Cat# D1306), 5mM Ethylenediaminetetraacetic acid (EDTA ...
-
bioRxiv - Physiology 2022Quote: ... CellTracker Green CMFDA Dye (C2925) and DAPI (4’,6-diamidino-2-phenylindole) (D1306) were from Invitrogen. EZ-Link Sulfo-NHS-LC-LC-Biotin (#21135 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Nuclei were then stained with 0.01% w/v 4’,6-diamidino-2-phenylindole dilactate (DAPI, Invitrogen) for 5 min and rinsed with ddH2O ...
-
bioRxiv - Neuroscience 2022Quote: ... Non-viable cells were excluded by staining with 4’,6-diamidino-2-phenylindole (Thermo Fisher, D1306). Flow-cytometric data were analyzed using FlowJo software (BD Biosciences).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 300nM 4’,6-diamidino-2-phenylindole dilactate (DAPI) (D1306, ThermoFisher Scientific, UK) for imaging assessment (Zeiss Axio observer Z1 microscope) ...
-
bioRxiv - Immunology 2021Quote: ... however Live/Dead stain was not performed and instead 4’-6’-diamidino-2-phenylindole (DAPI, ThermoFisher) was added immediately prior to sorting for live/dead detection ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Neuroscience 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) and Leica standard immersion oil were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were identified based on 4′,6-diamidino-2-phenylindole (DAPI; purchased from Thermo Fisher Scientific) staining before measurement of nuclear γH2AX and 53BP1 staining ...
-
bioRxiv - Microbiology 2022Quote: ... All stained sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, cat. no. D1306) at a concentration of 1 μg/mL for 15 minutes at room temperature and mounted using ProLong Glass Antifade Mountant (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... Tissues were counterstained with the nuclear marker 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen Cat# D1306) at a dilution of 1:1000 in diluent (Agilent Cat# S0809 ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining was done by 4’,6-diamidino-2-phenylindole (DAPI, catalog # D1306, Thermo Fisher Scientific). After several washes in 1xPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... single nucleus suspensions were stained with DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) at a concentration of 0.1μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 4x10min washes in PBS-Tr at RT with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) added during the third wash ...
-
bioRxiv - Cancer Biology 2024Quote: ... Counterstaining was done with 4’,6-diamidino-2-phenylindole ([DAPI], Thermo Fisher Scientific, #121101, 1µg/ml) for 15 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were mounted using Prolong Gold supplemented with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Specimens were examined on a Zeiss Axiovert 200M microscope and images captured with an Axio-Cam MRm camera ...
-
bioRxiv - Immunology 2024Quote: ... Dead cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA) (1.0 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... All IF sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, USA). Immunofluorescent images were acquired on an Olympus FV3000 microscope ...