Labshake search
Citations for Thermo Fisher :
6801 - 6850 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... cells washed 3 times with EBSS (GIBCO BRL, 24,010–043) and replaced with EBSS or Live Cell Imaging Solution (Molecular Probes ...
-
bioRxiv - Immunology 2021Quote: ... and for Calu-3 cells was MEM (Thermo Fisher 11090081) supplemented with GlutaMAX ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the QuantStudio™ 3 Real-Time PCR System (ThermoFisher). Each target mRNA was quantified in three biological replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... Figure 3) and 0.8-1.5 μl Lipofectamine 2000 (Life Technologies). After 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... medium supplemented with 25 ng/ml IL-3 (PHC0031, ThermoFisher), 2 mM Glutamax (35050061 ...
-
bioRxiv - Biochemistry 2022Quote: PRL-3 nanobodies were coupled to Dynabeads (Life Technologies, 14311D) for downstream 3XFLAG-PRL immunoprecipitation following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed using a 3% agarose (Thermo Fisher, BP160) gel in 1X Tris-Borate EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Delipidated brains underwent nuclear counterstaining with TO-PRO-3 (ThermoFisher) for a day ...
-
bioRxiv - Cell Biology 2022Quote: ... and resolved using NativePAGE 3-12% Bis-Tris gels (Invitrogen). For SDS-PAGE ...
-
bioRxiv - Biophysics 2022Quote: ... equipped with a Falcon 3 direct electron detector (Thermo Fisher) operated in linear mode ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with 3 μl of AnnexinV-PE conjugates (Thermo Fisher) and 0.1 μg/ml DAPI (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Borealin 3’ UTR siRNA (AGGUAGAGCUGUCUGUUCAdTdT) was transfected using RNAiMAX (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... then Liver Perfusion buffer (4ml/min for 3 minutes, Gibco), and finally the Liver Digest Medium (4ml/minute for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... and quantified by Qubit 3 Fluorometer (Thermo Fisher Scientific, Q10210). The purified DNA was sheared to a size of 250-450 bp by sonication using a Covaris M220 instrument (Covaris ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using a Qubit 3 Fluorometer (Thermo Fisher Scientific, MA, USA) and a Qubit Protein Assay Kit (#Q33211 ...
-
bioRxiv - Cell Biology 2019Quote: ... embryos were incubated in ToPro-3 (1/1000, Molecular Probes) for 1h as previously described (Roussigné et al. ...
-
bioRxiv - Pathology 2019Quote: ... The MCP-3 (Cat#: BMS6006INST) ELISA kit were from Invitrogen. The GCP-2 (Cat# ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 μL of 50 mg/mL BSA (Thermo Fisher, AM2616), 10 μL of 400 U/μL T4 DNA Ligase (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Biophysics 2019Quote: ... they were then washed 3 times in PBS (Invitrogen, 003000). Up to this fixation step ...
-
bioRxiv - Physiology 2019Quote: ... and with Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 4352934E, Applied Biosystems) as an endogenous control gene ...
-
bioRxiv - Microbiology 2019Quote: ... or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000; Ambion), or anti-p24 (1:1,000 ...
-
bioRxiv - Genomics 2019Quote: ... 3 µL of 50 mg/mL BSA (Thermo Fisher, AM2616), 10 µL of 400 U/µL T4 DNA Ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 µL of 50 mg/mL BSA (Thermo Fisher, AM2616), 10 µL of 400 U/µL T4 DNA Ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio 3 Real-Time PCR System (Thermofisher Scientific). Relative gene expression levels were calculated as 2(CtEef1a1 – Ctgene ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μl of BacLight Live/Dead reagent (Life Technologies, #L7012) was added to each well from an equal volume stock solution of SYTO9 and propidium iodide in DMSO and mixed thoroughly ...
-
bioRxiv - Neuroscience 2019Quote: ... together with 3 μL prestained protein ladder (ThermoFisher Scientific, 26619). The gels were run at 70 mV for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 3 µg/mL of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...