Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... on the PikoReal RT-PCR system (Thermo Fisher Scientific Inc.). An efficiency value of 100±10% was confirmed for both primer sets (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... and ABI 7500 RT-PCR system (Applied Biosystems, CA, USA). The 2-ΔΔCt method was applied to calculate the relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... The AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems) was used for the amplification of the VP1 protein in segment B ...
-
bioRxiv - Cancer Biology 2020Quote: ... using TaqMan one-step RT-PCR reagents (#4444434, Fisher Scientific). Primer mix for MARCH5 (Hs00215155_m1) ...
-
bioRxiv - Cell Biology 2021Quote: ... probes were used with Superscript III for RT-PCR (Invitrogen) using oligo-dT primers ...
-
bioRxiv - Genomics 2020Quote: We used a One-Step RT-PCR kit (Thermofisher 12595025) with custom primers to produce cDNA from the mRNA and subsequently ran 3 cycles of PCR which included a P5 adapter ...
-
bioRxiv - Cell Biology 2021Quote: The devices used are RT-PCR (Thermo Fisher Scientific, USA), micro reader (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... using the ViiA™7 RT-PCR System (Applied BioSystems). Quantification was performed by calculating the ΔCt value using GAPDH as a reference and results are shown as mRNA expression levels (2-ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time Q-RT-PCR system (ViiA7-96, Life technologies) was used to confirm specific knockdown of Tanc1 and Tanc2 by using SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... ORF2 was amplified by RT-PCR using Superscript IV (Invitrogen), followed by second strand synthesis using Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared by RT PCR kit (Superscript III, Invitrogen), and BECN 1 (1st-445th amino acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the QuantStudio 3 RT-PCR system (Applied Biosystems A28567). For determination of relative abundance of the CAGRAN intron region ...
-
bioRxiv - Genomics 2023Quote: ... and the QuantStudio 12K Flex RT-PCR instrument (Applied Biosystems) in 384-well plate format (10µL reactions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a QuantStudio 3 Flex RT PCR System (Applied Biosystems). Relative expression was determined using the Delta Delta Cycle method and normalizing to PPIA (cyclophilin A) ...
-
bioRxiv - Zoology 2024Quote: ... on a 7500 Real-Time RT-PCR System (Applied Biosystems). Specific primers and probes (Table S1 ...
-
bioRxiv - Bioengineering 2024Quote: RT-qPCR kit (CellsDirect One-Step qRT-PCR, Thermofisher, 11753100)
-
bioRxiv - Cancer Biology 2020Quote: For miR-375 knockdown specific miR-375 inhibitors (Assay ID: MH10327, Catalog: 4464084, Thermo Fisher Scientific, Frankfurt, Germany) or respective controls (Catalog ...
-
bioRxiv - Genetics 2020Quote: ... hsa-miR-147b-3p and hsa-miR-210-3p levels were assessed by TaqMan Advanced miRNA Assays (Thermofisher) and TaqMan Fast Advanced miRNA master mix (Thermofisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20nM hsa-miR-129-5p miRIDIAN mimics (miR-129 mimics) or mimic negative control (mimics ctrl)(ThermoFisher Scientific); 20nM has-miR-129-5p miRIDIAN hairpin inhibitor (miR-129 inhibitor ...
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR reaction was set up using Fast SYBR Green Mastermix (Applied Biosystems) and run in triplicates using StepOne Plus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... and used to set up qRT-PCR on the QuantStudio 6 (Applied Biosystems). JEV RNA level was determined by specific Taqman probes ...
-
bioRxiv - Physiology 2020Quote: All forward and reverse quantitative PCR (qPCR) primers (Table 1) were designed using Primer Express 3.0.1 (Applied Biosystems, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and target locus PCR amplified (forward primer: gatgcaggagggaaaagagagga, reverse primer: gcaaccaccacatacttccagt) using Platinum Taq DNA Polymerase (Invitrogen, 11304011). Amplicons were analyzed using Sanger sequencing and clones with frame shift deletions picked for expansion ...
-
bioRxiv - Genetics 2023Quote: ... All genotyping was done by SSLP PCR using primers designed in Primer Express 2.0 software (Applied Biosystems, Inc.) to bracket regions of dinucleotide repeats ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-PCR was performed on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) with LightCycler 480 SYBR Green I Master (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... Real-time RT-PCR was carried out using SYBR Green PCR Master Mix (Life Technologies), DNA template ...
-
bioRxiv - Developmental Biology 2021Quote: Quantitative PCR (RT-qPCR) was conducted using Power SYBR Green PCR Master Mix (Life Technologies) on a ViiA7 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was analyzed by quantitative real-time (qRT-PCR) RT-PCR (Applied Biosystems, 7500 Fast Real-Time PCR System ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR (RT-PCR) was performed on a QuantStudio 3 machine (Thermo Fisher Scientific). Primers/probe sets from Applied Biosystems were selected from the Thermo Fisher Scientific web site ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR was performed using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) and primer sets (Supplementary Table 1 ...
-
bioRxiv - Bioengineering 2020Quote: ... and prepared for RT-PCR using the SYBR Green PCR MasterMix (Thermo Fisher Scientific # 4309155). PCR was performed in a Viia 7 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... Quantitative RT-PCR was performed using SYBR® Green PCR Master Mix (Applied Biosystems™) on the 7500 Step OnePlus™ Real-Time PCR System (Applied Biosystems™) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR was performed using the SYBR™ Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time RT-PCR was performed with the SYBR Green PCR Master Mix (Applied Biosystems) using a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples went through Reverse Transcription-PCR (RT-PCR) using the cDNA kit (Applied Biosystems). cDNA samples for quantitative Real Time PCR were prepared using a mix of 1X Fast-SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was conducted with a Power SYBR Green PCR Master Mix (Thermo Fisher) and Applied Biosystems ViiA 7 Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific) and calculated using ΔΔCt-method ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was performed using Quant Studio 5 real-time PCR system (Applied Biosystems) and GoTaq qPCR Master Mix (Promega) ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR assays were performed using 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific), choosing the following TaqMan Real Time PCR Assays probes ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific) and calculated using ΔΔCt-method ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative RT-PCRs were performed on a ViiA 7 Real-Time PCR System (Life Technologies), using Brilliant II SYBR Green QPCR Master Mix (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR was performed using the SuperScript III One-Step RT-PCR kit (ThermoFisher Scientific) on a QuantStudio 7 Flex System (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time RT-PCR was conducted using the 7500 Real-Time PCR system (Applied Biosystems) with SYBR Green fluorescent probes using the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed with the QuantStudio™ 3 Real-Time PCR System (ThermoFisher). At the end of amplification ...
-
bioRxiv - Physiology 2022Quote: ... RT-PCR was run on a StepOnePlus™ Real-Time PCR system (Thermo Fisher Scientific). For data normalization ...
-
bioRxiv - Cell Biology 2020Quote: ... and used for real-time PCR (QuantiTech SYBR Green RT-PCR, Invitrogen; Bio-Rad iQ5). The primers used for RT-PCR are listed in Table 3.
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative RT-PCR was performed on a 7,500 Fast Real-Time PCR machine (Applied Biosystems) using SYBRTM Green Master Mix kit (ThermoFisher) ...
-
bioRxiv - Plant Biology 2021Quote: qRT-PCR was carried out on the QuantiStudio 7 Flex RT - PCR system (Applied Biosystems) and relative gene expression was calculated as 2-(Ct Target gene – Ct housekeeping gene ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT-PCR was run on a QuantStudio™ 3 real-time PCR machine (ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR was performed on a 7500 Fast Real-Time PCR System (Applied Biosystems) using the PowerUp SYBR Green Master Mix (ThermoFisher ...