Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Siglec 10 Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% v/v Fetal Calf Serum (FCS; Gibco/Life Technologies Ltd, Paisley, UK) (Supplementary Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... MDA-MB-231 cells were grown in DMEM/F12 with 10% FCS (Thermo Fisher Scientific) and 100 U μL/mL penicillin and 100 μL/mL streptomycin ...
-
bioRxiv - Immunology 2023Quote: TAP2 deficient CHO cells were cultured in complete RPMI (Invitrogen, 2mM glutamine and 10% FCS) and stably-transfected with >10g plasmid DNA using poly-L-ornithine and a 30% DMSO shock ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 10% fetal calf serum (FCS) and 1% L-glutamine (Gibco™ 25030-024). The human nasal septum epithelial cell line RPMI 2650 (ATCC CCL-30 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 10% FCS (Biosera, #FB-1280/500) and 2% glutamate/pyruvate (100mM sodium pyruvate, Invitrogen #11360-039 ...
-
bioRxiv - Cancer Biology 2023Quote: Hap1 cells (Horizon Discovery) were maintained in IMDM supplemented with GlutaMAX and 10% FCS (Gibco). Cells regularly tested negative for mycoplasma contamination.
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS, Capricorn) and 1% penicillin/streptomycin (Gibco). Huh 7.5 cells were maintained in complete DMEM medium supplemented with non-essential amino acids.
-
bioRxiv - Immunology 2023Quote: ... containing 10% FCS (Biochrome, Cat. S0615-500ML) and 1% Penicillin/ Streptomycin (Thermo Fisher, Cat. 7001592). After sorting ...
-
bioRxiv - Immunology 2023Quote: ... Pheonix cell and LS174T cells were cultured in complete DMEM (Gibco, 10% FCS, 2mM GlutaMAX).
-
bioRxiv - Cell Biology 2023Quote: ... Dissociation was stopped by addition of 2 volumes of DMEM-F12 with 10% FCS (GIBCO) and cells were counted ...
-
bioRxiv - Physiology 2024Quote: NIH-3T3 fibroblasts (3T3-FB, 1.0×104 cells) were cultured in 10 % FCS/DMEM (Gibco, Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in complete RPMI (10% FCS, 1% Penicillin/Streptavidin, 1% HEPES) supplemented with recombinant human M-CSF (10 ng/mL, Life Technologies) for 7-10 days to differentiate monocyte-derived macrophages (MDM) ...
-
bioRxiv - Cancer Biology 2019Quote: ... charcoal stripped FCS was used (CS-FCS, Gibco® Life Technologies). The human PCa cell line LAPC4 was kindly provided by Zoran Culig (Innsbruck Medical University ...
-
bioRxiv - Cancer Biology 2019Quote: ... charcoal stripped FCS was used (CS-FCS, Gibco® Life Technologies). The human PCa cell line LAPC4 was kindly provided by Zoran Culig (Innsbruck Medical University ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S GnTl- cells were cultured in Freestyle 293 (GIBCO) supplemented with 2% FBS and 1% Antibiotic-Antimycotic ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HEK293 cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293 cells were cultured in DMEM medium (Gibco/BRL) supplemented with 10% (v/v ...
-
bioRxiv - Genetics 2019Quote: HEK293 cells were maintained in DMEM plus Glutamax (Gibco) supplemented with 10% heat-inactivated FBS in a humidified 37°C ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviral particles were produced in HEK293-FT cells (Invitrogen). Then ...
-
bioRxiv - Microbiology 2021Quote: ... The proteins were expressed in HEK293 Freestyle cells (Invitrogen) in suspension culture using serum-free media (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... We cultured HEK293 cells in DMEM medium (Gibco, #11965092) with 10% fetal bovine serum and 1% penicillin– streptomycin ...
-
bioRxiv - Microbiology 2020Quote: ... transfected with 293fectin into FreeStyle HEK293-F cells (Invitrogen), and purified from culture supernatants by sequential HisTrap Ni2+-NTA and Superdex 200 columns (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells (ATCC CCL-2) and HEK293-FT (ThermoFisher) were cultured at 37 °C in 5% CO2 in medium composed of high glucose Dulbecco’s modified eagles medium (DMEM ...
-
bioRxiv - Synthetic Biology 2021Quote: HEK293 cells were cultured in DMEM (Gibco; Life Technologies) with 10% FBS (Gibco ...
-
bioRxiv - Synthetic Biology 2021Quote: HEK293 cells were cultured in DMEM (Gibco; Life Technologies) with 10% FBS (Gibco ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Flp-In™ T-Rex™ cells (Invitrogen) or HEK293T cells (ATCC ...
-
bioRxiv - Genomics 2021Quote: HEK293 cells (ATCC) were cultured in DMEM (ThermoFisher Scientific) with 10% FBS (Atlanta Biologicals) ...
-
bioRxiv - Cell Biology 2021Quote: ... Polyclonal HEK293 Flp-In T-REx cell lines (Invitrogen) were generated as described previously (Wyler et al. ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were dissociated with TrypLE (Thermo Fisher Scientific), washed ...
-
bioRxiv - Biophysics 2020Quote: HEK293 cells were transfected using Lipofectamine 3000 (Thermo Fisher). SERCA2a constructs were expressed using the mammalian expression vector pcDNA3.1 with G418 resistance ...
-
bioRxiv - Cell Biology 2020Quote: ... Flp-In T-Rex HEK293 (R78007, Thermo Fisher Scientific) and HaCaT (obtained from Joan Massague’s lab at Memorial Sloan Kettering Cancer Centre ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S GnTI- cells cultured in Freestyle 293 medium (GIBCO) supplemented with 2% FBS at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... for HEK293 FT cells and Lipofectamine 2000 (Thermo Fisher) for fibroblast cell lines ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa S3 and HEK293 T-REx (Thermo Fisher Scientific) cells were maintained in DMEM supplemented with 10% FBS in a humidified incubator at 5% CO2 and 37°C ...
-
bioRxiv - Genomics 2021Quote: HEK293 LTV cells were cultured in DMEM medium (Gibco), supplemented with 10% FBS at 37°C ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: The HEK293 cells were maintained in DMEM medium (Gibco) supplemented with 10% FBS and 50 U penicillin-streptomycin ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were transiently transfected using Lipofectamine 3000 (Invitrogen), following the manufacturer’s protocol.
-
bioRxiv - Genomics 2022Quote: ... We cultured HEK293 cells in DMEM medium (Gibco, #11965092) with 10% fetal bovine serum and 1% penicillin–streptomycin ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 cells were cultured in Advanced DMEM (Life Technologies) supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2022Quote: ... HEK293 and Jurkat cells were maintained in RPMI (Gibco) media containing 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Flp-In T-REx HEK293 cells (Thermo Fisher Scientific) were co-transfected with this expression vector and pOG44 Flp-recombinase expression vector in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were maintained in DMEM medium (Gibco, USA) supplemented with 1% penicillin-streptomycin solution (Gibco ...
-
bioRxiv - Genomics 2023Quote: HEK293 cells were transfected with Lipofectamine 2000 (Invitrogen, 11668019) at a ratio of 2.8 ul lipofectamine per ug of DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 and A549 cells were maintained in DMEM (Invitrogen) supplemented with 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293 cells were propagated in MEM with GlutaMAXTM (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: Human Embryonic Kidney Grip TiteTM (HEK293-GT) cells (Invitrogen) was used to create a polyclonal cell line expressing GluA2(Q)i as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were maintained in high-glucose DMEM (Gibco), supplemented with 10% (v/v ...