Labshake search
Citations for Thermo Fisher :
601 - 650 of 4764 citations for Scyliorhinin II amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... the 3’ end of rpc37 was first amplified by PCR and cloned into pCR Blunt II-TOPO using the Zero Blunt II TOPO PCR Cloning Kit (Invitrogen Life Technologies). Site-directed PCR mutagenesis was then carried out to mutate the codon corresponding to valine 189 (GTC into GAC ...
-
bioRxiv - Biophysics 2020Quote: Madin Darby canine kidney II (MDCK-II) (ECACC, Cat. No. 00062107) and MDCK Myr-Palm-GFP H2B-mCherry cells were cultured in DMEM (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... chloride hemipentahydrate (Cd2+), lead (II) nitrate (Pb2+), mercury (II) chloride (Hg2+), and hydrogen peroxide (H2O2, 30% in water) were purchased from Fisher Scientific. Buthionine sulfoximine (BSO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Add 100 µL Pol II antibody-conjugated beads (10 µg Pol II 8WG16 antibody conjugated with Dynabeads™ Protein G for Immunoprecipitation (ThermoFisher, #1004D)) and incubate on a tube rotator for 1 hour in the 4 °C room ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... Pellet 1 was subjected to a second round of digestion in 1 mL of 1000 U/mL Collagenase type II and 1 mL of 11 U/mL Dispase II (Thermofisher, Cat# 17105041) along with the 8 mL of the remaining cell suspension ...
-
bioRxiv - Plant Biology 2020Quote: ... the fragments were cloned into entry vector pDONR207 and yeast expression vector pYesdest52 using Gateway BP Clonase II Enzyme Kit and LR Clonase II Enzyme Kit (Invitrogen, MA, USA), respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR fragment obtained was cloned into pCR Blunt II TOPO using the Zero Blunt II TOPO PCR Cloning Kit (Invitrogen Life Technologies) and sequenced.
-
bioRxiv - Molecular Biology 2019Quote: ... the 3’ end of rpc37 was first amplified by PCR and cloned into pCR Blunt II-TOPO using the Zero Blunt II TOPO PCR Cloning Kit (Invitrogen Life Technologies). Site-directed PCR mutagenesis was then carried out to mutate the codon corresponding to valine 189 (GTC into GAC ...
-
bioRxiv - Cancer Biology 2021Quote: ... and reverse-transcribed using superscript II reverse transcriptase (Invitrogen). The qPCR study was carried out according to the established protocol using SYBR Green master mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... 8-well Lab-Tek II chambers (Thermo Fisher Scientific). To fix cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and cloned into pCR-Blunt II-TOPO (Thermo Fisher). Correct insertion of the homology arms was then verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... or Superscript II Reverse Transcriptase (ThermoFisher Scientific, Cat #180644022) following recommended manufacturer protocols ...
-
bioRxiv - Genomics 2021Quote: ... and HLA-DR/human MHC class II antibodies (Invitrogen Dynabeads® ...
-
bioRxiv - Molecular Biology 2021Quote: ... A BP reaction using BP Clonase II (Invitrogen, USA) was performed to clone the insert into pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesis was performed using the SuperScript II (Invitrogen). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dissociated cells were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and counted using a Countess II FL (Life Technologies). Single cell GEMs and subsequent libraries were then prepared using the 10X Genomics Single Cell V2 protocol with an additional anchor specific primer during cDNA amplification to enrich barcode sequences ...
-
bioRxiv - Plant Biology 2022Quote: ... SuperScript II reverse transcriptase (18064014; Invitrogen, Waltham, MA, USA) and up to 3 mg of total RNA were used ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μl Superscript II First-Strand Buffer (5x, Invitrogen), 0.1 μl MgCl2 (100 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... mRNA was reversed transcribed using Superscript II (ThermoFisher Scientific) and converted into second stranded DNA by DNA polymerase I (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... and reverse transcribed with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and dispase II (5 mg/mL, Thermo Fisher Scientific) at 37°C for 60 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissociated cells were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... cell suspensions were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was reverse transcribed using random decamers and M-MLV reverse transcriptase (Promega)/Superscript II RNase H reverse transcriptase (Thermo Fisher Scientific). Quantitative RT-PCR was performed on a BioRad CFX Connect system using iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... and ultrapure hydrogen peroxide (ULTREX II, 30%, Fisher Scientific). 30 lysate ...
-
bioRxiv - Genomics 2020Quote: ... and SuperScript™ II Reverse Transcriptase (Thermo Fisher, 18064014) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 25 mM sodium bicarbonate and 0.25% AlbuMAX II (GIBCO) or 5% heat-inactivated human sera in O+ RBCs from malaria-naive donors (Australian Red Cross blood bank) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and reverse transcription was done with Superscript II (Invitrogen) as previously described 68 using primer AM Dscam 13R2 (GCCGAGAGTCCTGCGCCGATTCCATTCACAG ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-Collagen Type II (Thermo Scientific, MS235B, 1:100), anti-Collagen Type X (Quartett ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized with SuperScript II Reverse Transcriptase (Invitrogen) from 1 µg of RNA sample ...
-
bioRxiv - Cell Biology 2019Quote: Cells were cytospun using Shandon Cytospin II (Thermo Scientific), dried and fixed in methanol ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using SuperScript II (Thermo Fisher) and qPCR using 2x Takyon for SYBR Assay – no ROX (Eurogentec ...
-
bioRxiv - Immunology 2019Quote: ... Using Phusion Hot Start II DNA Polymerase (Thermo Fisher) and DNA template (up to 1 μg ...
-
bioRxiv - Biochemistry 2020Quote: ... and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2019Quote: ... and cloned into pCR II-TOPO TA vector (Invitrogen). An AvrII site was introduced abutting the runt stop codon ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was done using SuperScript II RT (Invitrogen) and qRT-PCR was performed using SYBR FAST Universal 2X qPCR Master Mix (Kapa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was generated using Superscript II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... containing 1 mg/ml collagenase II (Thermo Fisher Scientific) for 2 h at 37 °C in a shaking water bath ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using SuperScript II Reverse Transcription (Invitrogen). Real time quantitative PCR was performed with KAPA SYBR FAST Universal reagent (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 µL Phusion HS II DNA Polymerase (ThermoFisher #F549L), and water to 50 µL ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 µL Phusion HotStart II HF Polymerase (ThermoFisher #F549L), and 31 µL water ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1.5g/L Manganese (II) chloride (MnC12•4H2O, Acros Organics), 1.3g/L iron (III ...
-
bioRxiv - Cancer Biology 2019Quote: ... rinsed with Nu-Clear II (Thermo Fisher Scientific, REF6769009), and then rinsed again first with tap water and then with Bluing Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 20mg/L Cobalt (II) chloride (CoCl2•6H2O, Acros Organics), 10mg/L Ammonium heptamolybdate ((NH4)6Mo7O24•4H2O ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 21mg/L Copper (II) sulphate (CuSO4•5H2O, Acros Organics), 10mg/L Thiamine (Acros Organics) ...
-
bioRxiv - Cell Biology 2020Quote: ... A Gateway reaction using LR Clonase II Plus (Invitrogen) generated the pTol2-ubi:mito-Keima,cryaa:Cerulean vector following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen). Taqman® Assays for FOS (Hs00170630_m1) ...