Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Recombinant Mouse ALCAM Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... 50 ng/ml human recombinant EGF (10450-013; Gibco), 3.0% Noggin/R- Spondin-conditioned media ...
-
bioRxiv - Cell Biology 2023Quote: ... 100U/mL RNAse OUT Recombinant Ribonuclear Inhibitor (ThermoFisher 10777019), and 1X complete EDTA-free Protease Inhibitor Cocktail (Sigma 11836170001)] ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant human thioredoxin 1 (hTrx) was purchased from ThermoFisher. The plasmid pET-TRSter for heterologous expression of human thioredoxin reductase (hTrxR ...
-
bioRxiv - Cancer Biology 2022Quote: ... growth factor 100ug/ml FGF10 (recombinant human) ( Thermo Fisher) and 500nM A-83-01 (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... on recombinant human Vitronectin (A14700, Thermo Fisher / Life Technologies)-coated 6-well plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... on recombinant human Vitronectin (A14700, Thermo Fisher / Life Technologies)-coated 6-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg/mL recombinant human insulin (Thermo Fisher Scientific), 0.55 µg/mL human transferrin (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... with or without recombinant IL-1β (50ng/ml)(Invitrogen; Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 50 ng/ml recombinant EGF (PMG8041, Thermo Fisher Scientific), 10% conditioned medium from a cell line producing Noggin (kind gift from Hans Clevers) ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 ng/mL recombinant human VEGF-165 (Gibco; PHC9391), 20 ng/mL recombinant human EGF (R&D system ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 ng/mL recombinant human VEGF-165 (Gibco; PHC9391), 20 ng/mL recombinant human EGF (R&D system ...
-
bioRxiv - Genomics 2024Quote: ... 20 ng/mL human recombinant EGF (Thermo Fisher PHG0311), and 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... growth factor 100ug/ml FGF10 (recombinant human) ( Thermo Fisher) and 500nM A-83-01 (Sigma) ...
-
bioRxiv - Genetics 2021Quote: ... Epitope-tagged bait proteins were detected with mouse anti-c-myc monoclonal antibody (Invitrogen, MA1-980) and IR-680 conjugated donkey anti-mouse secondary antibody (LI-COR ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Microbiology 2022Quote: ... eBioscience (minimal cross-reactivity to bovine/horse/mouse serum proteins)(Thermo Fisher Scientific 12-4998-82) diluted 1:200 in PBS/1% BSAfor 30 minutes.) ...
-
bioRxiv - Biochemistry 2022Quote: ... Bands of target proteins were visualized by western blotting with mouse anti-GFP (Invitrogen/Thermo Fisher) antibodies as primary antibodies and IRDye-800CW anti-mouse IgG (Licor ...
-
bioRxiv - Biochemistry 2022Quote: ... Bands of target proteins were visualized by western blotting with mouse anti-GFP (Invitrogen/Thermo Fisher) antibodies as primary antibodies and IRDye-800CW anti-mouse IgG (Licor ...
-
bioRxiv - Biochemistry 2021Quote: ... Bands of target proteins were visualized by western blotting with mouse anti-GFP (Invitrogen/Thermo Fisher), anti-Myc ...
-
bioRxiv - Biochemistry 2021Quote: ... Bands of target proteins were visualized by western blotting with mouse anti-GFP (Invitrogen/Thermo Fisher), anti-Myc ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody for p130 and mouse IgG were incubated with the Dynabeads Protein G (Invitrogen, 10003D) for 4 hrs at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subject to reducing SDS-PAGE and immunoblotted using antibodies recognizing recombinant protein (anti-NRG1 NRG1abcam ab180808 1:5000 dilution in 5% milk) or Lamin A (Invitrogen MA1-06101, 1:1000 in 3% BSA).
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng/ml recombinant human epidermal growth factor (Invitrogen, USA), 10 ng/ml human basic FGF (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... human recombinant Epidermal Growth Factor (5 ng/ml, ThermoFisher Scientific) and 0.15 mM CaCl₂ (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... coated with 5μg/ml human recombinant vitronectin (Life Technologies, #A14700) in mTesR1 (StemCell Technologies ...
-
bioRxiv - Immunology 2022Quote: ... and human recombinant epidermal growth factor (EGF; Gibco 10450-013). All cells were cultured at 37 °C and 5% CO2.
-
bioRxiv - Microbiology 2019Quote: ... and recombinant epidermal growth factor (10 ng/ml; Gibco-Invitrogen) at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2019Quote: ... and recombinant epidermal growth factor (10 ng/ml; Gibco-Invitrogen) at 37°C with 5% CO2 ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... with RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen cat# 10777-019).
-
bioRxiv - Cell Biology 2021Quote: ... RNaseOUT recombinant ribonuclease inhibitor (200 U/mL; Thermo Fisher Scientific) and IGEPAL® CA-630 (0.5 % ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant epidermal growth factor (EGF, 2 ng/ml, Gibco).
-
bioRxiv - Bioengineering 2020Quote: ... 12.5μg/ml Insulin human recombinant zinc solution (Thermo Fisher 1258014)] ...
-
bioRxiv - Biochemistry 2020Quote: ... 40 U RNase inhibitor (RNaseOUT ™ Recombinant Ribonuclease Inhibitor, Invitrogen), and various amount of DNA sample (see figures) ...
-
bioRxiv - Biophysics 2021Quote: Recombinant constructs were expressed in E.coli BL21 DE3 cells (Invitrogen) in Luria Bertani media ...
-
bioRxiv - Neuroscience 2019Quote: ... 200 units/ml RNaseOUT™ Recombinant Ribonuclease Inhibitor (#10777019; Thermofisher), and 1X cOmplete™ ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 10 ng/mL recombinant human TRAIL (Life Technologies, PH1634) in serum-free medium for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... and 40 U/μL of Recombinant Ribonuclease Inhibitor RNaseOUT (Invitrogen) at 25°C for 2 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies). After a three-day incubation period ...
-
bioRxiv - Cancer Biology 2022Quote: ... recombinant monoclonal cystatin A antibodies (Thermo Fisher Scientific, MA5-29200) were immobilized on the silica surface of the microtoroid through EDC/sulfo-NHS covalent coupling ...
-
bioRxiv - Developmental Biology 2022Quote: ... we created recombinant pCRTM4-TopoTM plasmids (Invitrogen, Carlsbad, CA, USA) containing 18S and 28S ribosome RNA PCR amplicons ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen) (hiPSC medium) ...
-
bioRxiv - Biochemistry 2022Quote: RNAseOUT™ recombinant ribonuclease inhibitor (ThermoFisher Scientific, cat. no. 10777019)
-
bioRxiv - Microbiology 2022Quote: ... 0.3 μg of recombinant human CDKL5 (1-498) (ThermoFisher, A33353) was combined with 3 μg of recombinant human SQSTM1/p62 protein (GeneTex ...
-
bioRxiv - Microbiology 2020Quote: ... AcMNPV recombinant bacmids were constructed with the bMON14272 bacmid (Invitrogen) and maintained in Escherichia coli strain DH10B (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 μL of RNaseOut™ Recombinant RNase Inhibitor (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant SRPK1 and PKR were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant clones were selected with 120 μg/ml Hygromycin (Invitrogen) and pooled to obtain a stable population maintained in medium containing Puromycin ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... 200 U/mL RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher, 10777019), 400U/mL RNasin (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Human recombinant TNFα was purchased from Invitrogen (Carlsbad, CA, USA). Puromycin was purchased from Funakoshi (Tokyo ...