Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Rat Heat Shock Protein Beta 8 HSPB8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 25% heat inactivated horse serum (Gibco), 25 mM glucose ...
-
bioRxiv - Genomics 2022Quote: ... + 10% heat inactivated FBS (ThermoFisher Scientific) in 50 mL falcon tubes (VWR International Ltd) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 12.5% heat-inactivated horse serum (Invitrogen), 1% penicillin and streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... 2% heat-inactivated horse serum (Gibco), 1% GlutaMAX ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10% heat-inactivated FBS (16140071, Gibco), 1mM Sodium Pyruvate (11360070 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 10 % heat-inactivated FBS (Gibco), and 1X glutamine/penicillin/streptomycin (Life Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 10 % heat-inactivated FBS (Gibco), 1X glutamine/penicillin/streptomycin (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... and 10% heat-inactivated HFBS (Gibco). Two days prior to infection ...
-
bioRxiv - Neuroscience 2023Quote: ... 20% heat-inactivated equine serum (Invitrogen), 2% B27 supplement (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... with 10% heat inactivated FBS (Gibco) in T75 or T175 flasks (Sarstedt ...
-
bioRxiv - Biochemistry 2023Quote: ... with 10% heat inactivated FBS (Gibco) and ...
-
bioRxiv - Genomics 2023Quote: ... plus 10% heat-inactivated FBS (Gibco), 1% penicillin/streptomycin (Sigma).
-
bioRxiv - Microbiology 2023Quote: ... containing 10% heat- inactivated FBS (Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin and seeded into 6 well- plate ...
-
bioRxiv - Microbiology 2023Quote: ... containing 10% heat-inactivated FBS (Gibco).
-
bioRxiv - Cancer Biology 2023Quote: ... plus 10% heat-inactivated FBS (Gibco), 2mM L-glutamine ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 10% heat-inactivated FBS (Gibco),100 U/ml penicillin and 100 μg/ml streptomycin and seeded into 6 well-plate ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 10% heat-inactivated FBS (Gibco).
-
bioRxiv - Genomics 2023Quote: ... plus 10% heat-inactivated FBS (Gibco), 1% penicillin/streptomycin (Sigma)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10% heat inactivated Horse Serum (Invitrogen), and 100 U/mL Penicillin/Streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... 7.2% Heat-inactivated Horse Serum (Gibco), 1x GlutaMAXTM supplement (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... IgM, and IgY were measured using an ELISA kit (Shanghai Yeyuan Biotechnology Company, China) and with an ELISA Reader (Thermo Fisher, Varioskan Flash, USA) following the manufacturers’ instructions ...
-
bioRxiv - Immunology 2019Quote: ... SHIV RNA was visualized with the 1-Plex ViewRNATM ISH Tissue Assay Kit using SIVmac239 or Beta actin (positive control) probe sets and ViewRNA Chromogenic Signal Amplification Kit (ThermoFisher, Waltham, MA). These two sequential slides were indivudually imaged with a Zeiss AxioObserver microscope and AxioCam MRm camera ...
-
bioRxiv - Neuroscience 2022Quote: ... BCA protein assay kit (ThermoFisher Pierce BCA Protein Assay) was used to determine the protein concentration ...
-
bioRxiv - Genetics 2020Quote: ... protein quantification using BCA Protein Assay Kit (Thermo Fisher) was done ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were quantified using BSA Protein Assay Kit (ThermoFisher). Equal amounts of protein were boiled with 6X loading buffer (375mM Tris HCL ...
-
bioRxiv - Immunology 2021Quote: ... Protein secretion levels in culture supernatant were quantified via ELISA for human IgG (Invitrogen, 50-112-8849) and human BAFF (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... Protein levels of IL-18 from intestinal biopsies were measured by ELISA (BMS618-3, ThermoFisher, Waltham, MA). Assays were performed according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Recombinant human CD81 protein (R &D Systems) was coated (4µg/ml) on ELISA plate (Thermo Fisher Scientific) and incubated overnight at 40C ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Immunology 2020Quote: ... the presence of N protein was determined using 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher).
-
bioRxiv - Cancer Biology 2023Quote: ... the dried pellet was resuspended in 8 M urea and quantified using the Pierce™ Rapid Gold BCA Protein Assay Kit (Thermo Fisher Scientific, USA). A 2 hour incubation with 10 mM DTT at 56 °C was followed by 40 mM iodoacetamide for 45 minutes in the dark at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... and rat anti-glial fibrillary acidic protein (GFAP) Mab (ThermoFisher Scientific #13-0300, 1:500). Sections were then washed in PBST and incubated with fluorophore-conjugated secondary antibodies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... a rat G-protein (Gα15i2) and a photoprotein (mt-apoclytin-II) using Lipofectamine 2000 (Invitrogen). Control cells were only transfected with plasmids for the rat G-protein and the photoprotein (without receptor plasmids) ...
-
bioRxiv - Physiology 2020Quote: ... 8 mg of the soluble protein fractions were pre-cleared with 200 μL of protein G-magnetic Dynabeads (Thermo Fisher Scientific) for 1 hr ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were then resolved on 4-12% Bis-Tris gels (for lower molecular weight proteins) or 3-8% Tris-Acetate gels (for higher molecular weight proteins) (NuPage, Thermo-Fisher Scientific) and run in MOPS or Tris-Acetate running buffer respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Purified surface proteins or total cell lysates were separated on a NuPage 3-8 % Tris-acetate protein gel (Thermo Fisher Scientific) at 200 V for 40 min and transferred to a PVDF membrane ...
-
bioRxiv - Genetics 2019Quote: ... 40-50μg of protein was analysed by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) using 3-8% NuPAGE Tris-Acetate protein gels (Life Technologies) and transferred onto nitrocellulose membrane using Xcell Sure Lock Mini Cell electrophoresis tanks (Novex ...
-
bioRxiv - Genomics 2020Quote: ... An estimated 60 µg of protein was loaded per well on a NuPAGE Novex 3-8 % Tris-Acetate Protein gel (Life Technologies), separated by electrophoresis and blotted on polyvinylidene fluoride membranes ...
-
bioRxiv - Physiology 2023Quote: ... 8 mg of the soluble protein fractions were pre-cleared with 200 μL of protein G-magnetic Dynabeads (Thermo Fisher Scientific) for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoretic run of samples containing 30μg of proteins was performed on precast NuPAGE 3-8% or 4-12% Tris-Acetate Protein Gels (Thermo Fisher Scientific), or on home-made acrylamide gels 8-15% ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were measured using the Bio-Rad Protein Assay Kit or BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts (25 μg or 10 μg ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein concentration was quantified using the “Protein Quantification BCA Assay” kit (Pierce BCA Protein Assay Kit, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... pseudovirus carrying a luciferase reporter and encapsulated in Omicron variant S proteins were incubated with six 4-fold serial dilutions of the heat-inactivated serum samples by DMEM (Gibco) for 1 h at 37℃ ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-Microglobulin-Mm00437762_m1 (Applied Biosystems, Waltham, MA). Gene expression levels were normalized to β-2-microglobulin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...