Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Drosophila S2 cells were mixed with Ramos cells or B1-8hi B cells at a ratio of 1:4 (4×105 B cells and 1×105 S2 cells) followed by total RNA extraction with TRIzol reagent (Thermo Fisher), DNaseI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... Raji cells were then labeled with 10 μM CMAC (7-amino-4-chloromethylcoumarin, Molecular Probes), pulsed with 1 μg/ml SEE (Staphylococcus enterotoxin E ...
-
bioRxiv - Bioengineering 2020Quote: HTM cells ± DEX at 7 d were fixed with 4% paraformaldehyde (PFA; Thermo Fisher Scientific) at room temperature for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1×10^7 parasitized RBCs were incubated with 4 µM BCECF-AM (B1170, ThermoFisher) and 0.02% Pluronic F-127 (p6867 ...
-
bioRxiv - Genomics 2019Quote: ... An ArrayControl RNA Spots and Spikes kit (with spike numbers 1, 4 and 7) (Ambion) were used to monitor technical variability ...
-
bioRxiv - Cell Biology 2022Quote: ... 20 μM Cell Tracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies, Carlsbad, CA) was added to 1 ml of mid-log cells 1 hour prior to imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... Presence of active BMP signalling pathway was detected by an antibody against the phosphorylated form of Smad1/5/9 protein complex (Cell Signalling Technology, Cat#13802S) or pSmad1/5 (Thermo Fisher Scientific, Cat#700047) as indicated in figures ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activity was assessed using CellEvent(tm) Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) following manufactures protocol ...
-
bioRxiv - Genomics 2021Quote: ... Laser Capture Microdissection (LCM; N=3; 7 µM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522), multiplex or regular immunohistochemistry (N≥3 4 µM glass slide ...
-
bioRxiv - Developmental Biology 2024Quote: ... follicles were incubated with 500 nM CellEvent™ Caspase-3/7 Green Detection Reagent (C10427, Invitrogen). Oocytes were stained with 150 nM Sir-Tubulin (CY-SC002 ...
-
bioRxiv - Biochemistry 2020Quote: ... with a feeding of 5% (v/v) CHO CD EfficientFeed B (Thermo Fisher Scientific) on days 2 ...
-
bioRxiv - Immunology 2022Quote: Purified naïve splenic B cells were stained with 5 μM CellTrace™ Violet (Invitrogen) in PBS for 20 minutes at room temperature in the dark ...
-
bioRxiv - Immunology 2019Quote: ... MRC5t cells were supplemented with 5 μg/mL hygromycin B (Thermo Fisher Scientific; 10687010) to maintain hTERT expression ...
-
bioRxiv - Immunology 2020Quote: ... CD4 (RM4-5) purchased from eBioscience and Granzyme B (GB12) purchased from Life Technologies. Staining of cytoplasmic and nuclear antigens was performed using the Fixation/Permeabilization kit (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... B cells were stained with 5 nM CellTrace™ Violet Cell (C34557, Thermo Fisher) for 8 minutes in 37L°C water bath ...
-
bioRxiv - Cell Biology 2021Quote: ... One milligram of protein was incubated with 4 µg of antibody (IgG (Rb, Invitrogen) or HA (Rb ...
-
bioRxiv - Cell Biology 2019Quote: ... cell were starved for 2h at 37°C using EBSS (ThermoFisher) and restimulated for 15min with complete medium.
-
bioRxiv - Cancer Biology 2019Quote: ... Blots were blocked for one hour with 3% (weight/volume) bovine serum albumin (Fisher Scientific) and incubated overnight at 4° C with a rabbit monoclonal antibody to RHAMM [EPR4055] antibody at 1:1,000 dilution (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined (Figure S4 ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Plant Biology 2023Quote: ... and 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was set to 45 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 3) injections of fluorophore-conjugated cholera toxin subunit B (CTB 488 or CTB 555; Invitrogen). These manipulations were all targeted to A2 ...
-
bioRxiv - Immunology 2023Quote: ... the chitin preparation was incubated for 3 h with 10 µg/ml polymyxin B (Thermo Fisher), washed by centrifugation ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 5 mL of digestion buffer [composed of 9 mL of phosphate-buffered saline (PBS; Gibco, 10010-023) combined with 1 mL of Dispase (stock ...
-
bioRxiv - Immunology 2023Quote: ... 5% glycerol and then mixed at 9 volumes to 1 volume of 200× concentrate SYPRO orange (Thermo Fisher) diluted in the same buffer ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cell Biology 2022Quote: ... with 9% FBS (ThermoFisher Scientific) and 50 U/ml penicillin ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix. The examined arrays contain the numbers of tag SNPs (array size ...
-
bioRxiv - Molecular Biology 2021Quote: Spodoptera frugiperda 9 (Sf9) (Invitrogen) and High Five™ insect cells (Expression Systems ...
-
bioRxiv - Microbiology 2020Quote: ... 0.4 μM SYTO-9 (Invitrogen) and 6 U Bst3.0 DNA polymerase (NEB ...