Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Northern blot analysis of U1 snRNA was performed using 5’-radiolabeled DNA probes (Sequence is listed in Supplemental Table 7) in ultrasensitive hybridization Buffer (Thermofisher). The radioactivity signals were analyzed by PhosphorImager (Typhoon FLA 7000).
-
bioRxiv - Synthetic Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from RNA extracted from ~30 pairs of ovaries or testes dissected from 5-7 days-post-emergence (dpe) Liverpool strain adults using Trizol (Invitrogen). Primers LA1076 then nested with LA1352 (5’ ...
-
bioRxiv - Immunology 2023Quote: Lungs were transferred into 7 ml bijoux tubes containing 500 µl digestion mix consisting of 5 mg/ml collagenase I (Gibco) and 10 µg/ml DNase I (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then dissociated using 0.5mM EDTA into a single cell suspension and incubated in 5 μM of cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) dye (Invitrogen) for 30 min at 37°C in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 5×105 Huh-7 cells were transfected with 2 µg of purified BAC DNA using Lipofectamine 3000 (Fisher Scientific) as a transfection reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 5-7 days once they reached about 70-80% confluency using TrypLE cell dissociation reagent (Gibco) and gentle scraping before being replated onto new MEFs ...
-
bioRxiv - Immunology 2023Quote: ... and washed with HBSS and resuspended in appropriate volume of HBSS pH 7.4 supplemented with 5% FBS before staining with 7-aminoactinomycin D (Life Technologies) to exclude dead cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 12.5 ng/mL IL-7 (Miltenyi, USA) and 12.5 ng/mL IL-15 (Miltenyi, USA) or RPMI 1640 (Gibco, USA) medium supplemented with 100 U/mL IL-2 (Sci-Store ...
-
bioRxiv - Cell Biology 2023Quote: ... Cyclin B14E7E cells were selected for 72 h with Nutlin-3A 5 µM and for 7 days with Geneticin (Gibco) 0.4 mg/ml ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells with Fzd1/2/4/5/7/8 knocked out were provided by Michael Boutros (Voloshanenko et al., 2017) and maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gemini) ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 5 × 105 Huh-7 cells were transfected with 2 μg of purified BAC DNA using Lipofectamine 3,000 (Fisher Scientific) as a transfection reagent ...
-
bioRxiv - Biochemistry 2024Quote: ... Liposomes at 5-7 mM were applied to the carbon side of a grid held in a Vitrobot Mark IV (ThermoFisher) chamber kept at 4°C and 100% relative humidity ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... the hypervariable V3 region of the 16S rDNA gene was amplified from 20 ng of DNA using the primers 5′-CCTACGGGAGGCAGCAG-3′ and 5′-ATTACCGCGGCTGCTGG-3′ (Integrated DNA Technologies BVBA, Leuven, Belgium),(18) 1U Platinum® PCR SuperMix High Fidelity (ThermoFisher Scientific) and 10 μM of primer-mix ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated in 0.05 M Tris-HCl buffer (pH 7.6) containing 5 mg 3-3′ diaminobenzidine (Thermo Scientific, TA-060-HDX) per 10 mL buffer and a final concentration of 0.01% hydrogen peroxide for 15 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... and hybridized first using RT primer (5′/5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′) and then reverse transcribed into cDNA using TSO primer (5′-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) and RT maxima reverse transcription (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (5′-AAGCAGTGGTATCAACGCAGAGT-3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Microbiology 2024Quote: ... and a pan VSG reverse primer which binds to a conserved 14bp region of the 3’ UTR (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) with AmpliTaq Gold (Applied Biosystems, 4398881) (anneal & extension 60C 1m ...
-
bioRxiv - Immunology 2021Quote: The enumeration of apoptotic cells was performed using the CellEventTM Caspase-3/7 Green Flow Cytometry Assay Kit (catalogue #: C10427; Thermo Fisher Scientific) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Human breast carcinoma cell lines (SK-BR-3, MCF-7, MDA-MB-231, T-47D) were cultured in GIBCO® RPMI 1640 (Life technologies) medium supplemented with 10% FBS (Life technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... culture medium was replaced with 100 µL full melanoma medium with 4 µM Caspase-3/7 activity dye (CellEvent, Thermo Fisher Scientific). Plates were then imaged on a Celigo Imaging Cytometer (Nexcelom ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were passaged on day 3 to maintain sub-confluent culture conditions and analyzed by flow cytometry on day 7 using an Attune NxT (Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2020Quote: ... Genital ridges from 1-2 litters (7-8 embryos per litter) were dissected out and digested at 37°C for 3 min using TrypLE Express (Thermo Fisher Scientific). For E9.5 and E10.5 stages ...
-
bioRxiv - Cancer Biology 2022Quote: ... At time of treatment the cells were also treated with 2μM CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen, ThermoFisher Scientific, Inc), which was used to measure apoptosis ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was extracted from 40 pairs of adult testes per sample per condition (3 to 7 days post-eclosion) using the PureLink RNA Mini Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... re-suspended in PBS containing a viability marker (7-AAD – 7-Aminoactinomycin, Invitrogen – A1310), filtered again through 70-µm cell strainers and incubated on ice for 5 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7 and 7 fish respectively and dissociated in 0.25% Trypsin-EDTA (Gibco, ThermoFisher Scientific) and 8 mg/ml Collagenase from Clostridum histolyticum (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... 7 and 7 fish respectively and dissociated in 0.25% Trypsin-EDTA (Gibco, ThermoFisher Scientific) and 8 mg/ml Collagenase from Clostridum histolyticum (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The samples were incubated overnight with Paired Box 7 (PAX 7) antibodies (Invitrogen, USA) in blocking solution at 4°C ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...