Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithioerythritol (Invitrogen), 2.50 U/μL reverse transcriptase (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... Claudin 5 (CLDN5) (Thermofisher, Cat No ...
-
bioRxiv - Pathology 2024Quote: ... on QuantStudio 5 (ThermoFisher) with primers specific to hamster genes encoding CCL2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% Horse Serum (Gibco), and 1x Antibiotic/antimitotic (Corning).
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 10 ng/mL human recombinant EGF (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... – 5% DMSO (Fisher Scientific). Protocol for thymic pDCs isolation was based on Stoeckle et al ...
-
bioRxiv - Genomics 2023Quote: ... 5-FU (Fisher Scientific), cytosine (Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... + 5 % FBS (Gibco #10500064) under antibiotic pressure using 5 μg/ml blasticidin (Gibco #A1113903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytokeratin 5 (AB_2538529, Thermofisher), Cytokeratin 8 (ab53280 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM MgCl2 (Invitrogen), 10 mM Tris buffer pH 8.0 (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 5% FBS (GIBCO, USA) and 20 μg/ml-1 penicillin streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... with 5% FCS (Gibco), MEM only ...
-
bioRxiv - Neuroscience 2023Quote: ... and penicillin/streptomycin (GIBCO)] and 5% FBS (GIBCO). After 2 hours incubation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). Lysis of the cells was performed using RLT lysis buffer (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). After 72h stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated upon shaking at the growth temperature for 5 min with following concentrations: FM 5-95 (2 µg/ml; Thermo Fisher Scientific), DiSC3(5 ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA sequences targeting CD33 exon 2 were 5’-TCCATAGCCAGGGCCCCTGT and 5’-GCATGTGACAGGTGAGGCAC.25 U937 cells were washed three times in PBS (Gibco 10010-023) and resuspended in complete Nucleofector Kit C (Lonza Biosciences VCA-1004 ...
-
bioRxiv - Pathology 2020Quote: ... Aliquots of 15 μL per sample were loaded at a rate of 5 μL/min onto a trap column (100 μm × 2 cm, PepMap nanoViper C18 column, 5 μm, 100 Å, Thermo Scientific) which was equilibrated with 98% Buffer A ...
-
bioRxiv - Cell Biology 2020Quote: ... organoids (after 1 week of culture) were incubated (37°C, 5% CO2, 1 h) with 10 µM EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher Scientific), a nucleoside analog of thymidine incorporated into DNA during active DNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: Whole protein extracts were prepared from JJN3 pellets (4°C, 150 x g, 5 min) according to the cell extraction protocol for ELISA sample preparation by ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Thymi from 4-week-old wild type mice were harvested and 5 million thymocytes per condition were cultured in IMDM medium (Gibco) with 2% FBS (HyClone Thermo Fischer Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... produced from DKO piglet were prepared and stained at 4°C for 45 minutes with Alexa 488-conjugated Griffonia simplicfolia isolectin IB4 (GS-IB4) (5 μg/mL, Invitrogen). The stained cells were washed twice and then analyzed by flow cytometer (BD Accuri™ C6 Plus) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were boiled at 95°C for 5 min before running on a NuPAGE 4-12% Bis-Tris protein gradient mini gel (Invitrogen) at 200 V for 5 min in MOPS running buffer (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Genetics 2020Quote: ... For morphological analyses 105 cells were resuspended in 200 ml PBS and spun (5 min, 400 rpm) in a Cytospin 4 (ThermoFisher), before staining with modified Wright’s Stain on a Hematek (Bayer Health Care) ...
-
bioRxiv - Genetics 2021Quote: ... 100 µL of the cell suspension were then placed in a cytofunnel and spun at 1200 rpm for 5 min with high acceleration using a cytocentrifuge (Shandon Cytospin 4; ThermoFisher). For FISH ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were heated to 50°C for 5 minutes before being loaded on 4-12% Novex WedgeWell Tris-Glycine gels (ThermoFisher).
-
bioRxiv - Bioengineering 2021Quote: ... 10 µg of each sample was boiled at 95°C for 5 min and loaded onto the 4-12% Bis-Tris Gel (NP0336, ThermoFisher). Gels were run for 1 hour and 15 min at 120 V in with NuPage MES Buffer (NP0002 ...
-
bioRxiv - Biophysics 2021Quote: Cells were magnetically labelled thanks to an incubation of 2h with a solution of iron oxide nanoparticles at [Fe] = 4 mM and supplemented with 5 mM citrate in RPMI medium (Gibco). The viability and the proliferation of cells after magnetic labelling were assessed by Alamar Blue showing no impact of the magnetic labelling right after the labelling or after one day (Supplementary Figure 1).
-
bioRxiv - Biochemistry 2021Quote: ... and samples were incubated at 70°C for 5 minutes and loaded onto Bis-Tris 4-12 % gradient gels (ThermoFisher). Bands were stained by CBB and relative band intensity was quantified by scanning and semi-automated analysis in ImageQuant (GE Healthcare).
-
bioRxiv - Neuroscience 2021Quote: ... Sections were blocked in PBS-T containing 5% NDS and then incubated overnight at 4°C with rabbit anti-PSD95 (1:1000, Invitrogen/ThermoFisher) and guinea pig anti-vGlut2 (1:10,000 ...
-
bioRxiv - Immunology 2020Quote: ... and anti-CD127-PE-Cy5 (clone eBioRDR5; 5 μL; cat. # 15-1278-42) all from Thermo Fisher (Supplementary Fig. 4). mAbs for chemokine receptors (i.e ...