Labshake search
Citations for Thermo Fisher :
601 - 650 of 8804 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Immunology 2024Quote: ... Monoclonal antibodies were diluted to 30 μg/mL and then serially diluted 1:3 to a final concentration of 1.52x10-3 μg/mL in PBST supplemented with 1% non-fat milk (Life Technologies). Following blocking ...
-
bioRxiv - Neuroscience 2024Quote: ... Brain sections were washed with 0.3% TX-100/PBS 3 times and then incubated with secondary antibody goat anti-rabbit IgG AlexaFluor 555 (A21528, Invitrogen) at room temperature for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
bioRxiv - Immunology 2024Quote: ... N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Propionyl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (triethylammonium Salt) (Bodipy-PE: #D3800) was purchased from Thermo Fisher Scientific.
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and res OVCAR-3 cells were maintained in RPMI-1640 medium (AL162A; HiMedia) supplemented with 20% FBS (10270; Gibco), while the COV362 and res COV362 cells were cultured in DMEM (AL007A ...
-
bioRxiv - Cancer Biology 2024Quote: ... The relative expression of each target was calculated using the relative quantification method (2-ΔΔCT) with RNA18S (5’-TGTGGTGTTGAGGAAA-GCAG-3’ and 3’-TCCAGACCATTGGCTAGGAC-5’; Invitrogen) as internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL lipofectamine RNAiMax (ThermoFisher, Cat No. 13778030) were diluted in 50 μL Opti-MEM (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified DNA was quantified using Qubit-3 (Invitrogen) and 10-100 ng of total DNA was used for library preparation using the KAPA Hyper Prep kit (KAPABiosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The GeneChip 3’ IVT PLUS Reagent Kit (Affymetrix/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... on Falcon 3 (Thermo Fisher Scientific-FEI, NL) camera operated in counting mode at an angular range of -60 ° to 60 ° in a bidirectional fashion and at an angular increment of 2° ...
-
bioRxiv - Genetics 2021Quote: ... and 3 x phosphatase inhibitor (Thermo Scientific, #78420)-supplemented RIPA buffer (bioWORLD ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with fluorescein (3 μM) (Thermo Fisher Scientific), which served as a FAM and protein only control ...
-
bioRxiv - Physiology 2020Quote: ... 14-3-3ζ-specific siRNA (Ambion, Austin, TX), GFP control plasmids ...
-
bioRxiv - Genetics 2021Quote: ... and mixed with 3 μl Lipofectamine RNAiMAX (ThermoFisher) diluted in 47 μl Opti-MEM I ...
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... and EdU (3 μM, Thermo Fisher, no. C10338) were added the following day (day 1) ...
-
bioRxiv - Biophysics 2021Quote: ... equipped with a Falcon 3 detector (Thermo Fisher). Movies were collected with EPU with a calibrated pixel size of 0.681 Å/pixel ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with recombinant murine IL-3 (Gibco, PMC0035) at 1 μg/mL (BaF3) ...
-
bioRxiv - Neuroscience 2020Quote: ... and the QuantStudio 3 detection system (Applied biosystems). Primer sequences are listed in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... labelled with TO-PRO-3 iodide (ThermoFisher Scientific), and mounted using ProLong Antifade (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... in 3% FBS in PBS (Gibco Cat# 14190144) in the dark at 4°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine (Thermo Fisher Scientific) and unesterified oleic acid (Nu-chek Prep ...
-
bioRxiv - Cell Biology 2021Quote: ... in 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... with a QuantStudio 3 analyzer (Thermo Fisher Scientific). Custom primers were designed with Primer-Blast online ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mM MgCl2 (AM9530G, Thermo Fisher Scientific) in water] supplemented with 0.1% Tween-20 (P2287 ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Quant Studio 3 instrument (Applied Biosystems). Data was analyzed by standard ΔΔCt method.
-
bioRxiv - Plant Biology 2021Quote: ROMT2-3 were amplified using TOPO-D (Invitrogen) compatible primers from cDNA derived from grapevine senescent leaves ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-DSC2/3 (326200, Thermo Fisher Scientific), mouse anti-N-Cadherin (NCAD ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added into 3 ml OptiMEM (Life Technologies). 100 ul of X-tremeGENE HP DNA Transfection Reagent was diluted in 3 ml OptiMEM and ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 3-8% Tris-Acetate gels (Thermo Fisher) for gel electrophoresis depending on the protein sizes of interest ...
-
bioRxiv - Cancer Biology 2021Quote: ... Then 3 µl of RNAse I (Ambion, AM2294) was added and the samples were incubated for 45 minutes at room temperature with shaking ...
-
bioRxiv - Cell Biology 2021Quote: Libraries were quantified by Qubit 3 fluorometer (Invitrogen) and quality was assessed by Bioanalyzer (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... using a Qubit 3 fluorometer (Thermo Fisher Scientific). To quantify H2O2 concentrations ...
-
bioRxiv - Biophysics 2021Quote: ... Approximately 3 mL Ni-NTA agarose (Thermo Scientific) was washed and pre-equilibrated with lysis buffer while the lysate was clarified by centrifugation (22,000 rpm for 30 min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Qubit™ 3 Fluorometer (Invitrogen, Life Technologies) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Qubit™ 3 Fluorometer (Invitrogen, Life Technologies) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-desmocollin 2 and 3 (clone 7G6, Thermofisher), 1:100 ...