Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 2 1 1 Diethoxy 2 methyl propyl 4' Nitrophenyl Carbonate d6 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’ ,6-diamidino-2-phenylindole; cat. no. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’, 6-diamidino-2-phenylindole; Cat. No. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Physiology 2024Quote: ... only 4 wells of cells were incubated in DMEM with 4 μM fura-2/AM (fura-2/AM, Molecular Probes, USA) at 37° C in the dark for 45 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Plant Biology 2021Quote: ... 30 μL of N-methyl-N-trimethylsilyltrifluoroacetamide plus 1% trimethylchlorosilane (MSTFA + 1% TMCS, Thermo Scientific) was added to the MSTFA vials ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µL n-propyl gallate solution (50 mg/mL n-propyl gallate (MP210274780, Thermo Fisher Scientific) and 16.3 mg/mL Tris base (648310 ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Microbiology 2021Quote: ... a sequencing reaction was performed with 2 pmol of unmodified RNA and 2 µl of a 2 mM AS primer 1 labeled with Ned (Life Technologies SAS, France). Reverse transcription was performed as for the SHAPE (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... packaging plasmid psPAX2 and pMD2G in a ratio of 2:2:1 using lipofectamine 3000 (ThermoFisher, L3000001) and transduced into NES cells and ONS76 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... serum-free medium (DMEM:F12 at 2:1) supplemented with N2 (1% v/v; Invitrogen), 1mM L-glutamine ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2% B27 and 1% L-glutamine and 1% Pen-Strep (Life Technologies). Dissociated cortical neurons were infected with Control and Ncan shRNA AAVs at 7 days in vitro (DIV ...
-
bioRxiv - Biochemistry 2024Quote: ... Solutions were further diluted to 1 µM using 2:1 MeOH:CHCl3 (ThermoFisher Scientific, Australia) with 5 mM ammonium acetate (SigmaAldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2% B27 and 1% L-glutamine and 1% Pen-Strep (Life Technologies). Dissociated wildtype and Ncan KO cortical neurons were initially infected with Control and the two Ncan shRNA AAVs at 7 days in vitro (DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa647 ICAM-2 at 1:100 and Live/Dead at 1:1000 (L34962, Invitrogen), for sorting of CD45neg ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibody (2-3% serum, 0.4% PBST, 1:500 Invitrogen A11035, 1:500 DAPI) was applied and incubated for one hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 1% pen/strep and 1% (v/v) L-glutamine (2 mM final concentration, Gibco). Cells were maintained at 37°C and 5% CO2.
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM 2-mercaptoethanol and 1 mM PMSF) by sonication (using a Fisher Scientific Sonic Dismembrator with a Qsonica Ultrasonic Sonicator converter ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a 2:1:1 ratio using Lipofectamine 3000 transfection reagents (Invitrogen, Cat. L3000015). Viral supernatants were collected 48 hours after transfection and filtered through a 0.45-μm membrane (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were selected with 1 μg ml-1 and 2 μg ml-1 puromycin (Thermo Fisher Scientific) respectively for 10 days.
-
bioRxiv - Molecular Biology 2024Quote: ... cells were selected with 1 µg mL-1 and 2 µg mL-1 puromycin (Thermo Fisher Scientific), respectively.
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with 4 μM fura-2 acetoxymethyl ester (fura-2/AM, Invitrogen, Cat# M1291) in HEPES-buffered solution (137 mM NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Bioengineering 2024Quote: ... PCs and ACs were stained with neural/glial antigen 2 (NG-2) antibody (eBioscience, 14-6504-80, 1:100) and glial fibrillary acidic protein (GFAP) antibody (Invitrogen, PA1-10019, 1:1000), respectively ...
-
bioRxiv - Genetics 2024Quote: ... 2 µL of a 1:100 dilution of ERCC ExFold RNA Spike-In Mix 1 or Mix 2 (Thermo Fisher Scientific, #44-567-39) were added to 1 µg of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with various concentrations of propylparaben (Propyl 4-hydroxybenzoate, PP; Acros Organics, CAT: 131591000), methylparaben (Methyl 4-hydroxybenzoate ...
-
bioRxiv - Neuroscience 2021Quote: ... 2°: goat anti-mouse AF488 (1:500) (Invitrogen, A-11001), and donkey anti-rabbit Cy5 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... and ethidium homodimer-1 (2 mM in DMSO, L3224, ThermoFisher) were added directly to the cell medium to a final concentration of 1 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... stained with Neurotrace for 2 hours (1:500, N21479; Invitrogen), rinsed twice with 2x SSCT and mounted on a slide with Fluoromount-G ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were loaded with 1 μM fura-2 AM (Invitrogen) for 40 min before the measurements at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Physiology 2021Quote: ... with 2 μM JC-1 dye (M34152, Thermo Fisher Scientific) at 37 °C in a 5% CO2 incubator for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and diamidino-2-phenylindole (DAPI) (1:500, Thermo Scientific, 62247).