Labshake search
Citations for Thermo Fisher :
6101 - 6150 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... was also used with the TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems). For a complete list of primer names and sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Thermal cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher, AB4101C) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... fix viability dye (LIVE/DEAD Fixable Aqua Dead Cell Stain Kit; 1:200; Invitrogen) and conjugated antibodies were added (see below ...
-
bioRxiv - Immunology 2019Quote: THP-1 cells were transfected with siRNAs using the Lipofectamine2000 Kit (Invitrogen, #11668-019) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA (1 μg) was reverse transcribed using the Verso cDNA Synthesis Kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... We used the TaqMan® RNA-to-Ct™ 1-Step Kit (Applied Biosystems® by Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5–1 μg was retrotranscribed using the TaqMan reverse transcription kit (Applied Biosystems). Real-time qPCR was performed using primers (MmDrosha Fw:5’ TGCAAGGCAATACGTGTCATAG 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-miR-181a-1 in vitro synthesis was performed using T7 MEGAshortscriptTM kit (Ambion) from 1 µg purified DNA and following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µg of RNA was treated with 1 µl of DNAse (Invitrogen TURBO kit) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... using a Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific), which also contains RNase inhibitor and ROX dye for passive referencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was used to make cDNA (SuperScript VILO cDNA Synthesis Kit, Invitrogen). Quantitative RT-PCR was performed with iTAQ Syber Green using 1/40th of the cDNA reaction per sample and the appropriate primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were quantified by Qubit 1× dsDNA HS Assay kit (#Q33230, Thermo Fisher Scientific). The libraries for each sample were pooled at 4 nm concentration and sequenced using an Illumina NovaSeq 6000 system (S4 PE150) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mitochondrial membrane potential was calculated using the MitoProbe JC-1 assay kit (Thermo Fisher). All media and oil were pre-equilibrated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... mRNA levels were determined using Taqman RNA-to-Ct 1-step Kit (Applied Biosystems) following manufacturer’s guidelines.
-
bioRxiv - Cell Biology 2023Quote: ... and 1 μg reverse transcribed using the MMLV reverse transcriptase kit (#28025021; ThermoFisher scientific). TNFα ...
-
bioRxiv - Biophysics 2023Quote: ... an MMP reporter dye that targets mitochondria [49] (ThermoFisher, Mitoprobe JC-1 assay kit), to the control and treated groups ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified by Qubit 1× dsDNA HS Assay kit (#Q33230, Thermo Fisher Scientific). The libraries for each sample were pooled at 4 nm concentration and sequenced using an Illumina NovaSeq 6000 system (S4 PE150) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HET(1) and HET(2) hESCs was extracted using mirVana microRNA isolation kit (ThermoFisher). Small RNA libraries were generated using NEXTFlex Small RNA Library Prep Kit v3 (Cat #NOVA-5132–06 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... medium was removed and cells were lysed directly on plate in RNA lysis buffer and processed using the MagMAX® mirVana Total RNA Isolation Kit (Thermo Fisher Scientific Inc., Cat. No. A27828) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples were diluted 1:100 prior to RT-qPCR with Power SYBR Green RNA-to-Ct 1-step kit (Applied Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... F2 progeny of all crosses were screened for fzo-1(tm1133) and/or pdr-1(gk448) mutations using a single worm PCR Phire Animal Tissue Direct PCR Kit (Thermo Scientific). The resultant amplification products were visualized by gel electrophoresis ...
-
bioRxiv - Bioengineering 2021Quote: ... solution (1 mg/mL in DMEM) with 1:50 Cy5 dye-labeled fibronectin (conjugated in house using dialysis kit from Life technologies) was added on the chip and incubated for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested and 1 million cells were incubated with 1:100 LIVE/DEAD Fixable Near-IR Dead Cell Stain Kit (Life Technologies), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8% CO2 with 125 rpm rotation to a density of 3.0 x 106 live cells per mL of culture were transiently transfected with an appropriate plasmid at 1 μg of DNA per 1 mL of culture using the Expifectamine transfection kit (Thermo Fisher) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were then covered with a mix of 1 ml of Reagent A and 1 ml of Reagent B from a Pierce ECL western blotting substrate kit (Thermofisher, 32106). Excess liquid was removed ...
-
bioRxiv - Genomics 2019Quote: ... the tissues were washed thrice in PBT for 20 minutes each and incubated in Alexa fluor 568 goat anti-mouse (1:200, Invitrogen Molecular Probes, Carlsbad, CA, USA) for two hours with constant agitation ...
-
Basolateral amygdala parvalbumin neurons report aversive prediction error to constrain fear learningbioRxiv - Neuroscience 2020Quote: ... Sections were washed in PB for 20 min and then incubated in 1:1000 Alexa-488 goat anti chicken (Molecular Probes Cat# A-11039, RRID:AB_142924) and 1:750 Alexa-594 goat anti-mouse (Molecular Probes Cat# A-11032 ...
-
bioRxiv - Neuroscience 2020Quote: ... For GFP immunohistochemistry sections were incubated in anti-GFP antibody (dilution 1:20 000, polyclonal rabbit-anti GFP, A6455, Life Technologies, Grand Island, NPY, USA) for 48 hours at 4C ...
-
bioRxiv - Neuroscience 2021Quote: ... For tail vein injections 1 h prior to euthanasia we used 20 μg α-Bungarotoxin conjugated with Alexa Fluor 647 (B35450, Thermo Fisher Scientific, Massachusetts, USA) or 30μg Alexa Fluor 647 conjugated CD31 Antibody (102516 ...
-
bioRxiv - Physiology 2020Quote: ... For real time quantitative PCR (qPCR) analyses ∼20 mg of snap-frozen liver tissue was homogenized in the 1-mL TRIzol reagent (Thermo Fisher Scientific, Cat. No. 15596018). Furthermore ...
-
bioRxiv - Bioengineering 2019Quote: ... was diluted 1:200 in PBS/5% FCS/0.1% Tween® 20 and primary MMP1 antibody (mouse anti-human; Invitrogen Thermo Fisher Scientific, monoclonal, MA5-15872) was diluted 1:500 in PBS/5% FCS/0.1% Tween® 20 and incubated according to the manufacturer’s instruction for 3 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Excess secondary antibody was then blocked by adding the corresponding normal serum at 1:20 v/v ratio and the mixture was incubated for 5 minutes at room temperature (Thermo Fisher Scientific, #10410 and #10510). The complex was used immediately for staining of cells and tissue sections.
-
bioRxiv - Cell Biology 2019Quote: ... 24 aliquots of human blood (20 μL) from each donor were pipetted into 1 mL 2D-barcoded tubes (Matrix Storage Tubes; Thermo Fisher Scientific Inc., Waltham, MA), placed into a ANSI/SLAS microplate format compatible 96-tube racks (8 × 12 ...
-
bioRxiv - Neuroscience 2022Quote: ... Next day cells were washed with PBS containing 0.1% Tween- 20 and then incubated by secondary goat rabbit Alexa Fluor 488 antibody (Thermofisher, 1:1000 in PBS/4%BSA) at room temperature in the dark ...
-
bioRxiv - Immunology 2022Quote: ... cells were washed once with flow cytometry staining buffer and incubated on ice for 20 min with 1:100 diluted anti-mouse IgG antibody conjugated to PE fluorophore (Thermo Fisher, Cat. No. P-852). After the final wash with flow staining buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed twice with PBST and incubated for 20 min at room temperature in the dark with 1-Step™ NBT/BCIP substrate solution (Thermo Fisher scientific, Waltham, MA). After incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tilt-series were collected from the samples from ±65° with 1° increments at 200 kV in Tecnai 20 electron microscopes (FEI, Thermo Fisher Scientific, Eindhoven, the Netherlands). Tilt series were recorded at a magnification of 19,000x ...
-
Spray-induced gene silencing (SIGS) as a tool for the management of Pine Pitch Canker forest diseasebioRxiv - Plant Biology 2024Quote: ... 1999).1 µL of the extracted DNA was used in 20 µL reactions of Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher, Waltham, MA, USA) containing 0.4 µL of 1:1000 SYBR™ Green I Nucleic Acid Gel Stain (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... samples were pelleted by centrifugation at 16,000 x g for 1 min and resuspended in complete lysis buffer consisting of 20 μL protease cocktail inhibitor III (Thermo Scientific cat no. J64283-LQ), 5 μL RNase A (Invitrogen cat no ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using 2 μL of 1:5 diluted cDNA in a 20 μL volume reaction with a PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), as described previously (30) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cortex from right hemispheres in each group were homogenized by sonification for 20 seconds in radio immunoprecipitation assay (RIPA) lysis solution containing 1 mM phenylmethylsulphonyl fluoride (PMSF; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with phosphatase and proteinase inhibitors ...
-
bioRxiv - Microbiology 2020Quote: ... were grown overnight in 600 μL of LB at 37°C in a 1 mL-volume 96-deep-well plate (Thermo Scientific; catalogue number 260251), aliquoted in 96-well plates with 15% glycerol ...
-
bioRxiv - Developmental Biology 2019Quote: ... FACS-purified CD31+CD146+ primed vs naïve VP populations were expanded in EGM2 medium ∼7 days to 60 to 70% confluency on fibronectin pre-coated 6-well plates (1-1.5 x 105 cells/well) prior to Dil-Ac-LDL uptake assays (Life Technologies, Cat No. L-3484). Fresh EGM2 medium supplemented with 10 μg/mL Dil-Ac-LDL ...
-
bioRxiv - Bioengineering 2021Quote: ... and each lobe was cultured statically in a 6 well plate in cell culture media (DMEM high glucose, 10% FBS, 1% pen-strep) (Thermo Fisher Scientific, Waltham, MA). Media was changed on days 1 ...