Labshake search
Citations for Thermo Fisher :
6051 - 6100 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... qPCR protocol and subsequent analysis was executed using a QuantStudio 5 thermal cycler (Applied Biosystems). Primer and probe sequences will be available at the time of publication ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were then counterstained for 5 minutes with Hoechst 33342 (1μg/mL, Thermo Scientific, 62249). Slides were mounted using Vectashield Antifade Mounting Medium (Vector Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... RNA was then eluted from beads by incubation with 5 µg Proteinase K (Thermo Fisher) at 50°C with shaking (1000 rpm) ...
-
bioRxiv - Genetics 2023Quote: ... cells were trypsinized for 5 minutes with 0.25% Trypsin-EDTA (252-000-56, Fisher Scientific), spun down after deactivation with equal amount of the stem cell media ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were grown at 37°C in 5% CO2 in DMEM low glucose (Gibco 11885) supplemented with 10% heat inactivated FBS (F4135 ...
-
bioRxiv - Cell Biology 2023Quote: ... from 5-30% solvent B (LC-MS grade 0.1% formic acid (#A117, Thermo Fisher Scientific) and acetonitrile ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with a mix of 5 µM Fura-2 AM (Invitrogen™, F1221) and 0.025% Pluronic® F-127 (diluted in CM ...
-
bioRxiv - Cell Biology 2023Quote: ... 5×105 EPCAM+ cells in 200 μl CMM medium based on DMEM/F12 (Gibco, 11320033) supplemented with 1 mM L-glutamine (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... B-cells were cultured at 37 °C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Biochemistry 2023Quote: ... the coverslip was mounted on a glass slide using 5 μL SlowFade (Invitrogen Life Technologies) and the edges sealed with fingernail polish ...
-
bioRxiv - Bioengineering 2022Quote: ... Real time qPCR was performed using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) using a total reaction volume of 20 μL ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were grown at 37°C under 5% CO2 in DMEM/F12 medium (11039047, Gibco), supplemented with 5% charcoal (C6241 ...
-
bioRxiv - Bioengineering 2022Quote: ... 100Å) with a C18 nano Viper trap-column (0.3 mm ×5 mm, Thermo Fisher Scientific) was used for peptide elution and separation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems) and the THUNDERBIRD NEXT SYBR qPCR Mix (TOYOBO) ...
-
bioRxiv - Molecular Biology 2023Quote: MCF10A cells were cultured in DMEM/F12 (Nacalai Tesque) supplemented with 5% horse serum (Gibco), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were counterstained by Hoechst 33342 (Thermo Fisher Scientific, 2 μg/mL, 5 min, RT), and slides were mounted in ProLong Gold antifade mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... BM cells were incubated with MitoSOX Red (5 μM, Thermo Fisher Scientific, Cat. No. M36008) at 37 °C in PBS and then with appropriate BM progenitor or monocyte makers plus viability dye for 20 min at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... MRC-5 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1 ...
-
bioRxiv - Microbiology 2022Quote: ... Biotin was detected using a streptavidin-conjugated AlexaFluor488 (5 μg/ml; Thermo Fisher Scientific; S11223). Virus and mock inoculations in non-enzymatic-treated cells were included as positive and negative infection controls ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated in blocking buffer (2,8 mM KH2PO4, 7,2 mM K2HPO4, 5% goat serum [Gibco, Billings ...
-
bioRxiv - Immunology 2023Quote: Cells were loaded with 5 μg/mL Indo-1 AM per manufacturer’s instructions (Life Technologies) and stained with lineage markers B220 ...
-
bioRxiv - Neuroscience 2023Quote: ... Eyes were embedded in Richard-Allan Scientific Neg-5 Frozen Section Medium (Thermo Fisher Scientific) and sectioned at 16 μm ...
-
bioRxiv - Microbiology 2023Quote: ... seeded at 5 x 106 cells/mL in black polystyrene Nunc 96 well plates (Thermofisher), were cultured in RPMI supplemented with 10% heat inactivated fetal calf serum (FCS) ...
-
bioRxiv - Plant Biology 2023Quote: ... a 5 mg/mL stock in EtOH (Ethanol 99.5%, HPLC grade, J.T. Baker /Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... For cryosections we used 0.5% Triton X-100 with 5% Donkey Serum (Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Reduction of proteins was achieved with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (Thermo Fisher) for 30 min and samples were subsequently alkylated in 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP and RFP DNA was quantified by PCR using QuantStudioTM 5 Real-Time (Applied Biosystems) and normalized to human GAPDH (hGAPDH) ...
-
bioRxiv - Molecular Biology 2023Quote: ... after a short incubation (30 minutes) with EU (5-ethynyl uridine, Thermo Fisher Scientific, E10342) and in the presence or absence of a MYC inhibitor (64 µM ...
-
bioRxiv - Biochemistry 2023Quote: ... Integrants were selected based on resistance to 1.5 mg/ml 5-fluoroorotic acid (Fisher Scientific) and validated by whole-cell PCR using primers homologous to endogenous flanking sequences in combination with those within the ORF ...
-
bioRxiv - Microbiology 2023Quote: ... for 5 min and purified by GeneJET RNA Cleanup and Concentration Micro Kit (ThermoFisher, K0841). The poly(A)-tailed total RNA samples were reverse transcribed and PCR-amplified into full length cDNA following the Oxford Nanopore Technologies PCR cDNA Synthesis (PCS109 ...
-
bioRxiv - Developmental Biology 2023Quote: ... microdissected fetal thymi were dissociated for 5 minutes in TrypLE Express Enzyme (Life Technologies 12604013) in an Eppendorf Thermomixer (1400 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... the germinated seeds were incubated in 50 μM 5-ethynyl-2′-deoxyuridine (EdU; Invitrogen, USA) for 15 min (CLEM ...
-
bioRxiv - Immunology 2023Quote: ... 5% CO2 in CTS™ OpTmizer™ T-Cell Expansion SFM (ThermoFisher Scientific Cat# A1048501). Four million cells in 2 mL media were cultured in the plate coated with or without 10 ng/mL of CD3 antibody (Clone SP34-2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 5% heat-inactivated fetal bovine serum (Biowest, #S1260) and antibiotic-antimycotic (Gibco, #15240062) at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... Cells were spun down at 400xg for 5 minutes and resuspended in LCK buffer (ThermoFisher) for 3 min to lyse red blood cells ...
-
bioRxiv - Immunology 2023Quote: ... or 5 µg/ml mouse IgG2a kappa Isotype control (eBM2a) APC (Thermo Fisher Scientific, USA) as the isotype control ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were subsequently incubated with the blocking solution (5% Skim Milk Powder (10651135, Fisher Scientific) added to tris-buffered saline (TBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NBL-W-S were grown at 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... which was immediately neutralized by adding 5 μl aliquots of 5M NaOH (Fisher Scientific, MA). Stem Cell Qualified ECM Gel (CC131-5ML ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR plates were run using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) with a total reaction volume of 20 µL ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Neuroscience 2023Quote: ... hiPS cells were cultured on vitronectincoated plates (5 μg ml−1, Thermo Fisher Scientific, A14700) in Essential 8 medium with supplement (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were cultured in air with 5% CO2 at +37°C with DMEM (Gibco) containing 10% fetal bovine serum (BioWest) ...
-
bioRxiv - Microbiology 2023Quote: ... 200 µl clarified lysate were combined with 5 µl RNase I (10 U/µl, Invitrogen). Reactions were incubated at RT for 45 min with shaking ...
-
bioRxiv - Microbiology 2023Quote: ... dried and mounted on microscopy glass slides with Prolong Diamond antifade 5 (Thermo Fisher Scientific). Slides were cured overnight at room temperature and imaged on a spinning disk Eclipse Ti2-E inverted microscope (Nikon) ...
-
bioRxiv - Neuroscience 2023Quote: ... that was supplemented with heat-inactivated 10% FBS and 5% HS (Gibco, Billings, MT, USA), 2 mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... CP-R: 5’GGGGACCACTTTGTACAAGAAAGCTGGG TCCTGCACAGAACCTACTCC3’) and subcloned into the Gateway entry vector pDONR 221 (Invitrogen) by BP reaction and finally recombined into the destination vector pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector (Dai et al. ...
-
bioRxiv - Biochemistry 2023Quote: In vitro transcribed RNA was 5’ dephosphorylated using FastAP™ thermosensitive alkaline phosphatase (Thermo Scientific) according to manufacturer’s recommendations ...