Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 0.5% Albumax II (Gibco), 0.36 mM hypoxanthine (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% AlbuMAX II (GIBCO).
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Albumax II (Gibco)) under a 1% O2 ...
-
bioRxiv - Physiology 2024Quote: ... SuperScript II RT (Invitrogen) was added to each reaction and incubated at 42°C for 50 minutes prior to enzyme inactivation by heating at 70°C for 15 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent secondary antibodies (1:500, Invitrogen), and Hoechst 33342 (Invitrogen H3570) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Secondary antibodies (1:500) from Invitrogen conjugated with Alexa fluor-488 ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor antibodies (1:500; Invitrogen) were used as secondary antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... pneumophila antibody (Invitrogen, PA17227; 1:1000) at RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies: C2orf88 (Thermofisher, dilution 1:50), CD45 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor antibodies (1:500; Invitrogen) were used as secondary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... β-actin antibody (Invitrogen, Cat:A5441, 1:10,000,000), anti-CHK1 antibody (Cell Signalling ...
-
bioRxiv - Immunology 2019Quote: ... biotinylated secondary antibodies (1:500, Invitrogen) were added and incubated at RT for 1hr ...
-
bioRxiv - Neuroscience 2022Quote: ... secondary antibody (1:500, Life Technologies) and c-FOS chromogenically with a biotinylated donkey anti-rabbit (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... pneumophila antibody [1:1,000 (Invitrogen; PA17227)] in DMEM 10%HIFBS supplemented with 1 mM IPTG for 20 min at room temperature (RT ...
-
Single-nucleus RNA-seq identifies transcriptional heterogeneity in multinucleated skeletal myofibersbioRxiv - Cell Biology 2020Quote: ... Secondary AlexaFluor antibodies (1:200) (Invitrogen) were then applied at room temperature for 1 hour ...
-
bioRxiv - Bioengineering 2020Quote: ... Primary antibodies (CD31, 1:100, Invitrogen, 14-0319-82 ...
-
bioRxiv - Cell Biology 2019Quote: ... Occludin antibody (Invitrogen, 711500 1:200), MyosinIIA antibody (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... AlexaFluor secondary antibodies (1:1000 Invitrogen) were used for 1.5 hours at room temperature to detect the antigen ...
-
bioRxiv - Cell Biology 2021Quote: ... AlexaFluor secondary antibodies (1:1000 Invitrogen) were used for 1.5 hours at room temperature to detect the antigen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antibodies: IB4 (Thermofisher, I21411, 1:250), Anti-RFP (Abcam ...
-
bioRxiv - Physiology 2022Quote: ... secondary antibody (dilution: 1:500, ThermoFisher). Fluorescent images were captured by an LSM 880 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... AlexaFluor secondary antibodies (1:100) (Invitrogen) were applied at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies (Invitrogen, 1:1,000 dilution) were applied together with Hoechst 33258 DNA dye (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies (Molecular probes, 1:2,000) were incubated for 1-2 hours (RT) ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies were mouse anti-MF20 antibody (1:100, 14650382, Invitrogen) and rabbit anti-TMSB4X antibody (1:200 ...
-
bioRxiv - Genetics 2019Quote: ... Secondary antibodies were goat anti-rabbit antibodies (ThermoFisher Scientific, 1:500) and goat anti-mouse antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Genetics 2020Quote: ... Secondary antibodies used were Alexa conjugated secondary antibodies 1:400 (Invitrogen). Samples were mounted on slides using glycerol 70% ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies were anti-rabbit A488 antibody (1:400, Invitrogen, #A21206), anti-rabbit Cy3 antibody (1:400 ...
-
bioRxiv - Bioengineering 2022Quote: ... Secondary antibodies were species-specific AlexaFluor secondary antibodies (1:2,000, ThermoFisher).
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were detected with secondary antibodies from Invitrogen (1:300): donkey anti-rabbit conjugated to Alexa 555 (A31572) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were detected with secondary antibodies from Invitrogen (1:300): donkey anti-rabbit conjugated to Alexa-488 (A21206 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used were rabbit anti-GFP antibody (1:1,000; Molecular Probes), rabbit anti-DYNC1H1 antibody (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated in rabbit anti-RIM 1/2 antibody (1:200) followed by donkey anti-rabbit AF647 antibody (1:500; Invitrogen).
-
bioRxiv - Pathology 2024Quote: ... Antibodies to TOM70 (14528-1-AP, 1:200, Proteintech; Alexa Fluor 488-conjugated secondary antibody: A-11034, 1:500, Invitrogen), and troponin T (1:100 ...
-
bioRxiv - Pathology 2024Quote: ... were stained in LV cryosections of 10 µm using a rabbit antibody to TOM70 (14528-1-AP, 1:200, Proteintech; Alexa Fluor 488-conjugated secondary antibody: A-11034, 1:500, Invitrogen) and a mouse Alexa Fluor 647-conjugated antibody to TnT (#565744 ...
-
bioRxiv - Cell Biology 2021Quote: ... and rabbit anti-Dnah5 antibody (1:2000, see below) and the secondary antibodies were goat anti-Rabbit antibody (1:500, Alexa Fluor 488, Life Technologies, A11008) and goat anti-Mouse antibody (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... OC antibody of 1:25,000 and A11 antibody of 1:500 (Millipore and Life Technologies, respectively; (34)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 hour in secondary antibody (1:500, Alexa Fluor 568 donkey anti-mouse antibody, (Thermo Fisher Scientific Cat# A10037 ...
-
bioRxiv - Genetics 2019Quote: ... and then reverse-transcribed into cDNA using Superscript II or II (Thermo Fisher) following the standard protocol ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Evolutionary Biology 2023Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were seeded at low and high density in 6-or 12-well plates coated with 0,2% type 1 Collagen (Gibco) and grown in PM for 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... bone marrow cells were flushed from femurs of lipin-1 fl/fl (wild type) and lipin-1m KO mice with Dulbecco’s modified Eagle’s medium (DMEM; Gibco, 10829). Cells were centrifuged at 534xg for 5 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... untreated polymer bottom slides were used followed by bovine Type 1 collagen coating (50 μg/ml, A10644-01, Gibco). For the soft and medium stiffness groups ...
-
bioRxiv - Immunology 2022Quote: ... lungs were cut into small pieces and digested in RPMI solution containing collagenase type 1 (ThermoFisher Scientific Waltham, MA) for 1 hr at 37°C in an agitating incubator ...