Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Rat Corticosteroid 11 Beta Dehydrogenase Isozyme 2 HSD11B2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Cell Biology 2020Quote: Cardiomyocytes were isolated from the left ventricle of 1–2-day-old Sprague-Dawley rats following the protocol from an isolation kit (Cellutron Life Technologies, cat#nc-6031). Myocytes were then plated on cover slips coated with laminin (Life tech #23017-015 ...
-
bioRxiv - Microbiology 2021Quote: ... and 11 µl of ultrapure water (Invitrogen). Primers used for human ACE2 PCR were Forward 5’ CTA GCT GTC AAG CTCTTC CTG GCT C 3’ and Reverse 5’ GGA TCC TAA AAG GAG GTC TGA ACA TCA TCA 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... and 11 µl of ultrapure water (Invitrogen). Primers used for animal (except chicken ...
-
bioRxiv - Immunology 2022Quote: ... PD-1-FITC (11-9985-82, Invitrogen), CTLA-4-PE (12-1522-82 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and EpCAM-FITC (11-5791-82, ThermoFisher). Following negative selection for CD45 and EpCAM ...
-
bioRxiv - Bioengineering 2019Quote: ... - CD40L/CD154-FITC (11-1548-42, ThermoFisher), -CD25-PE (120257-42 ...
-
bioRxiv - Biochemistry 2021Quote: ... individual TMT 11-plex reagent (ThermoFisher Scientific), vortexed ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.05 mM biotin-11-dUTP (Thermo Scientific); 10 mM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... IgD (Clone 11-26c, Thermo Fisher Scientific), CTLA4 (Clone UC10-4B9 ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD3-AF700 (11-0039-42, ThermoFisher), Sytox Blue Viability Stain (S34857 ...
-
bioRxiv - Systems Biology 2022Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Takara ...
-
bioRxiv - Immunology 2022Quote: Busulfan (Fisher Scientific, Cat# 11-101-7872) was dissolved in DMSO and diluted with 0.9 percent saline to obtain of 5 mg/ml busulfan in 30% DMSO ...
-
bioRxiv - Systems Biology 2023Quote: ... 1-methylnicotinamide (Fisher Scientific 11-101-2274), reduced glutathione-ester (MilliporeSigma G6013-5G) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Omega Scientific ...
-
bioRxiv - Pathology 2023Quote: ... Ly-6G (ThermoFisher Scientific, 11-9968-82), cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... Collagenase 11 (2mg/mL; Gibco; 17101-015), DNAse (20U/mL ...
-
bioRxiv - Immunology 2023Quote: ... CD11b-FITC (Invitrogen, Cat. 11-0112-41), CD31-BV711 (Biolegend ...
-
bioRxiv - Immunology 2023Quote: ... CD34-FITC (ThermoFisher Scientific 11-0341-81), CD16/32-PE (Biolegend 133310 ...
-
bioRxiv - Plant Biology 2024Quote: ... 11 μl of RnaseCocktail (ThermoFisher, ref AM2288) were added and the lysate was incubated in a rotator at 37°C for 20 minutes ...
-
bioRxiv - Plant Biology 2024Quote: TMT (11-plex) reagents (ThermoFisher, Cat#A34808) were reconstituted in anhydrous acetonitrile (0.01mg/uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Omega Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-Beta Galactosidase (1:1000, Life Technologies), mouse anti-Beta Galactosidase (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Microbiology 2023Quote: ... and beta-actin (Thermo Fisher Scientific, MA5-15739). Fluorescent secondary antibodies were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... and electroporated into MegaX 10 beta cells (Invitrogen). Transformations were recovered in 1mL of SOC for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... After that cells were incubated for 30 minutes in live-cell imaging solution containing 2 μM C-11 BODIPY (Invitrogen). Cells were then washed with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Another digestion was conducted using 1000 U/mL collagenase type 2 and 11 U/mL dispase (Gibco, Cat# 17105-041) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... All the signals were normalized to that of beta-actin (loading control) and the 2−ΔΔCT analysis method was used for quantification (Life Technologies). Primer sequences were designed by use of Primer3Plus software ...
-
bioRxiv - Immunology 2020Quote: ... The cells were blocked with 5 % skim milk-PBS for 1 hour at RT and incubated with an antibody against SARS-CoV-2 spike (BLSN-005P, Beta Lifescience) or control IgG (Thermo Fisher) at 4 °C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... VIM (Hs00958111_m1) and glyceraldeyde-3-phosphate dehydrogenase (GAPDH) (Hs02758991_g1) were purchased from ThermoFisher Scientific ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... Mouse monoclonal antibodies against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (# 4300) were from Ambion. Secondary antibodies conjugated with horseradish peroxidase were from Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... A rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer and probe set (Applied Biosystems) were included in each reaction to normalize the DNA added ...
-
bioRxiv - Microbiology 2023Quote: ... the cellular glyceraldehyde 3-phosphate dehydrogenase (GADPH) with SuperScriptTM III Reverse Transcriptase (Invitrogen) and quantified using SYBR-Green (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... Cell viability was measured using CyQuant lactate dehydrogenase (LDH) cytotoxicity assay (ThermoFisher Scientific) in a 96-well plate.
-
bioRxiv - Microbiology 2019Quote: ... Probes were labeled with Bio-11-UTP during in vitro transcription with the MAXIscript T7 Kit (Ambion) from PCR-derived DNA templates containing a consensus T7 promoter fused to the appropriate sequence.
-
bioRxiv - Neuroscience 2023Quote: ... 10 individual samples and one composite sample were labeled using the TMT 11-plex kit (ThermoFisher 90406). Labeling was performed as previously described (Higginbotham et al. ...
-
bioRxiv - Immunology 2019Quote: The concentration of sPD-1 and sTim-3 was measured in thawed plasma samples by enzyme linked immunosorbent assay (ELISA) using Human PD-1 (PDCD1) ELISA kit [EHPDCD1] (Thermo Fisher Scientific, Waltham, MA USA) and Quantikine ELISA Human TIM-3 Immunoassay kit [DTIM30] (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed using 1-Step Ultra TMB ELISA substrate (Life Technologies), with the reaction being terminated with 0.5M H2SO4 ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed using 1-Step-Ultra TMB ELISA substrate (Life Technologies), terminating the reaction with 0.5 M H2SO4 ...
-
bioRxiv - Immunology 2020Quote: ELISA of SARS-CoV-2 antigens was performed by coating antigens on MaxiSorp 96-well plates (ThermoFisher) at 2 µg/mL in 1X PBS [pH 7.4] overnight at 4 °C ...