Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Bcl2 Like Protein 14 BCL2L14 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... FOXP3 (eBioscience Affymetrix, 14-4777, clone 236A/E7, 1:300) and Opal540 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cytokeratin 14 (clone LL002) (mouse IgG3, 1:500, Invitrogen), GM130 (clone 35 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti EOMES (Thermo Fisher, 14-4877-82, 1:500), rabbit anti TBR1 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: Neurons were transfected at DIV12-14 using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations and used 4-5 days after shRNA transfection or 1 day after transfection of other constructs.
-
bioRxiv - Microbiology 2023Quote: ... Isotype control mouse IgG1 (P3.6.2.8.1; 14-4714-81 from Invitrogen), mouse IgG2b (MG2B00) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred to 12-14 kDa cutoff dialysis tubing (Fisher Scientific), and dialyzed overnight at 4°C against 12L deionized water ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred to 12-14 kDa cutoff dialysis tubing (Fisher Scientific), dialyzed for 3 days at 40°C against 4L deionized water (changed twice daily) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred to 12-14 kDa cutoff dialysis tubing (Fisher Scientific), and dialyzed for 3 days at 40°C against 4L deionized water (changed twice daily) ...
-
Single-cell profiling and zebrafish avatars reveal LGALS1 as immunomodulating target in glioblastomabioRxiv - Cancer Biology 2023Quote: ... and anti-SOX2 (ThermoFisher Scientific, 14-9811-82, 1:150) antibodies (Supplementary Table 1) ...
-
bioRxiv - Genetics 2023Quote: ... anti-CD4 (#14-9766-82, eBioscience, ThermoFisher, GmbH, 1:100), anti-CD8 (#14-0808-82 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Ki-67 (1:200, Invitrogen, 14-5698-82); goat anti-PDGFRa (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse anti-APP (22C11, Thermo Fisher Scientific, 14-9749-82), rabbit anti-BACE1 (EPR19523 ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse CD45 (clone 30-F11, Invitrogen #14-0451-85), and anti-mouse CD45-BV605 (clone 30-F11 ...
-
bioRxiv - Neuroscience 2023Quote: ... and CD16/CD32(1/200, ThermoFisher Scientific, #14-0161-82). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... we cleaned glass vials (Thermo Fisher Scientifc, 14-955-331) and Hamilton glass syringe (Avanti ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-MHC class II (Invitrogen cat#14-5321-82)(1:100 dilution) ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD90 (Thy-1) 1:100 (Invitrogen, #14-0909-82), and anti-DLK-1 1:100 (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... rat anti-PDGFRA (1:200, 14-1401-82, Invitrogen, AB_46749), goat anti-ITGA8 (1:20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-KI67 (KI67, 1:1000, 14-5698-82, Invitrogen), guinea pig anti-lysosomal associated membrane protein 3 (LAMP3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat monoclonal anti- Nanog (14-5761-80, Thermo Fisher Scientific), 1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were transfected at DIV13-14 using Lipofectamine 2000 (Invitrogen) in accordance with manufacture’s manual with minor modifications57 ...
-
bioRxiv - Cancer Biology 2024Quote: ... rat anti-mouse MHCII (Invitrogen, 14-5321-82, IHC-F), rabbit anti-human SFTPC (Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... or anti-CD11b PE (1:200; ThermoFisher, cat#14-480185) were then added to the slides overnight at 4°C followed by washing with PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... was from BD biosciences and viability dye (65-0865-14) from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody shifts were done by incubating the protein/extract with 4uL of antibody (α-Twist: Invitrogen PA5-47824 ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were probed with primary antibodies and detected by incubation with HRP-conjugated secondary antibodies (Invitrogen). The following primary antibodies were used ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... MCF-10 human mammary epithelial cells and COS-7 fibroblast-like monkey cells were maintained in DMEM (Fisher Scientific) supplemented with 10% fetal bovine serum and 2% penicillin/streptomycin.
-
bioRxiv - Microbiology 2021Quote: ... A549 (male, human lung epithelial-like) cells were obtained from ATCC and grown at 37 °C in DMEM (Gibco) supplemented with 10 % FBS (GE Healthcare Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... African green monkey kidney fibroblast-like cell line (COS-7) was maintained in minimal essential medium (MEM, Gibco/BRL) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Plant Biology 2023Quote: ... 14 mg protein were used for pulldowns with 200 µl streptavidin beads (Dynabeads® MyOneTM Streptavidine T1, Invitrogen; 0.5 x complete and 0.5 mM PMSF added). Beads were washed twice with cold buffer 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... protein lysates were immunoprecipitated with anti-GFP antibody conjugated to protein A-coupled polyacrylamide beads (#53142 Thermo Scientific) for 2 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... “Protein extracted” with T7 tag antibodies were incubated with protein A containing magnetic beads (Dyna beads, Thermo fisher) for 2 hours at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100µL of Dynabeads Protein A or Protein G (Invitrogen) plus 20µL of antibody) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100μL of Dynabeads Protein A or Protein G (Invitrogen) plus 20μL of antibody) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The antibody-DNA complex was precipitated with protein A/G magnetic beads or protein A sepharose beads (Invitrogen). After washing ...
-
bioRxiv - Immunology 2023Quote: ... Protein-antibody complexes were immunoprecipitated by rotating the samples with 40 μL protein A-agarose beads (ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... The antibody-protein complex was recovered with protein A coupled to magnetic beads (Dynabeads, Invitrogen, Cat No. 10002D), followed by extensive washes with low salt immune complex wash buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The antibody-binding proteins were pulled down using protein A conjugated magnetic beads (Thermo Scientific, Cat No.88845) and washed by repeated centrifugation and homogenization ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified from culture supernatants by protein A agarose beads (Thermo Fisher PierceTM Protein A Agarose, 20333). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... SNO proteins were detected by the anti-TMT antibody (ThermoFisher Scientific).
-
bioRxiv - Genomics 2019Quote: ... Antibody-bound chromatin was incubated with Protein G Dynabeads (Invitrogen, 10004D) for 4 hours at 4’C and eluted in Tris buffer (10mM Tris pH 8.0 ...