Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Genomics 2023Quote: ... HuC/D (mouse, 1:200, Invitrogen), SOX1 (goat ...
-
bioRxiv - Neuroscience 2023Quote: ... HuC/D (mouse, 1:200, Invitrogen), KI67 (rabbit ...
-
bioRxiv - Genetics 2022Quote: ... 1 nM D-biotin (Invitrogen #B20656) and 2% raffinose.
-
bioRxiv - Cancer Biology 2024Quote: ... TRACER rolls and unrolled control samples were incubated at 37 °C in complete organoid media with 50 μM of 5-Iodo-2’deoxyuridine (IdU, Fisher Scientific) and 20 uM of Telox64 (courtesy of Mark Nitz ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Developmental Biology 2021Quote: ... and further cultured in the DMEM/F12-based medium (D-MEM/F12 supplemented with 4% KSR additive, 1% ITS-X (Gibco), 0.3 % BSA (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from one lung lobe collected at 3 dpi using lysing matrix D (MP Biomedical) containing 1 ml of TRIzol reagent (Ambion, Life technologies) and homogenization at 20 s at 4.0 m/s twice using MP Biomedical Fastprep 24 Tissue Homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell pellets were then resuspended and plated into one well of a 6 well plate (Fisher Scientific 1483211). Cells were left to sit for 5 days at 37°C and 5% CO2 after initial plating and were only fed once after three days by adding an additional volume of FCM ...
-
bioRxiv - Neuroscience 2023Quote: ... EBs were seeded on one well of a 6-well plate coated with poly-Ornithine/Laminin (Thermo Scientific). Medium was changed every other day ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Bioengineering 2024Quote: ... NK cells and target cells were mixed at an effector to target (E/T) ratio of 4:1 (SK-BR-3 cells) or 2:1 (K562 cells) and Sytox Green (Thermo Fisher Scientific) was added at 100 nM ...
-
bioRxiv - Cell Biology 2022Quote: ... DNP (EM 1:6-1:30, #71-3500, Invitrogen), DPP4 (IF/FACS 1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... One portion was incubated for 16 h at 4°C with Dynabeads (Thermo Fisher Scientific) directly conjugated to anti-CD9 antibody with rotation ...
-
bioRxiv - Cancer Biology 2022Quote: ... proteins were separated by one-dimensional gel electrophoresis (4–12% NuPAGE Bis-Tris Gel; Invitrogen), and the entire lane of a Coomassie blue-stained gel was cut into 23 slices ...
-
bioRxiv - Molecular Biology 2019Quote: ... One fourth of the eluted samples was separated on 4-12% NuPage gels (Life Technologies) and the gels stained with coomassie blue (ProtoBlue ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures (n=3) were transferred as one sample into 250 μl RNAlater (ThermoFisher, Cat# AM7020) and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were then stained with DAPI (4’,6- diamidino-2-phenylindole, dihydrochloride, ThermoFisher, 62247 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Nuclear stain: 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were cover-slipped using ProLong Gold anti-fade reagent (InVitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... Nuclear stain: 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2ng/ml; Molecular Probes). Sections were cover-slipped using ProLong Gold anti-fade reagent (InVitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; Molecular Probes). Pictures were taken using a TCS SP5 Inverted confocal (Leica ...
-
bioRxiv - Genetics 2021Quote: ... Tissue slides were also stained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) to visualize the total number of nucleated myocardial cells within each section ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated in 4’,6-diamidino-2-phenylindole (DAPI, Acros Organics–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were counterstained using 4’,6-Diamidino-2-Phenylindole (DAPI – Life Technologies, D1306) diluted in PBS before being mounted on microscope slides with ProLong Gold Antifade Mountant (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher), fixed with 4% paraformaldehyde in PBS and incubated for 10 min at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... Primary antibodies together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS were incubated overnight at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... the DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific) diluted 1:10,000 with PBST ...