Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 4 4 7 Triethoxy 7 Methyl 3 8 Dioxa 4 7 Disiladecane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and a ViiA 7 Real Time PCR System (Applied Biosystems). For each primer pair in a given experimental condition ...
-
bioRxiv - Biophysics 2021Quote: ... for days 0-7 and RPMI with B-27 (Gibco) on days 7-onwards ...
-
bioRxiv - Immunology 2021Quote: ... using a ViiA 7 Real-Time PCR System (ThermoFisher Scientific) as described(44) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Data analysis was carried out using QuantStudio 7 (Applied Biosystems). Relative expression levels of target genes were calculated using the ΔΔCt method as described [12] with Actb ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections (7 um) were collected onto superfrost slides (Fisher Scientific). In situ hybridization was performed using the RNAscope multiplex in situ hybridization kit (Advanced Cell Diagnostics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and a ViiA 7 Real-Time PCR System (Applied Biosystems). The primer concentration used was 1 µM in a final reaction volume of 10µl ...
-
bioRxiv - Neuroscience 2022Quote: ... and ViiA™7 Real-Time PCR System (Life Technologies). PCR consisted of 40 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a ViiA 7 Real-time PCR System (Applied Biosystems). Primer sequences used are listed in Table S13.
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... on a ViiA-7 Real-Time PCR system (Applied Biosystems). Determination of relative mRNA levels was calculated using the comparative 2-CT method [20] compared to the expression of housekeeping gene receptor like protein 32 (RPL32 ...
-
bioRxiv - Immunology 2020Quote: ... in a ViiATM-7 RT-PCR system (Thermo Fisher Scientific). Primer sequences are available upon request ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Four technical replicates were averaged for each sample per primer reaction ...
-
bioRxiv - Pathology 2021Quote: ... qRT-PCR was performed on a ViiA 7 (Life technologies) using fast SYBR Green (Applied Biosystems) ...
-
bioRxiv - Genetics 2021Quote: ... in a Viia 7 RT-PCR machine from Applied Biosystems. All experiments were performed with least three biological replicates collected from different days ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dead cells were stained with 7-AAD (A1310, ThermoFisher Scientific) and were excluded from collections ...
-
bioRxiv - Biochemistry 2021Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). GAPDH expression functioned as internal control ...
-
bioRxiv - Microbiology 2021Quote: ... and the ViiA 7 real-time PCR system (Life Technologies). The oligonucleotide primers used for the qPCR analysis of gene expression are listed in Table S2 ...
-
bioRxiv - Neuroscience 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). A complete list of primers is provided in supplementary material (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems). Data were normalized to GAPDH expression ...
-
bioRxiv - Bioengineering 2021Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences are presented in Table S3.
-
bioRxiv - Neuroscience 2021Quote: ... 7 dpf larvae were exposed to 5 mM BAPTA (Invitrogen) in E3 for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... The QuantStudio 7 Flex Real-Time PCR System (Life Technologies) was used for qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... The QuantStudio 7 Flex Real-Time PCR System (Life Technologies) was used for qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Molecular Probes, Eugene, OR, USA). Conidia were incubated in an optimized minimal medium for 20 h at 25°C ...
-
bioRxiv - Genomics 2021Quote: ... on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). DNA contamination was assessed omitting the RT ...
-
bioRxiv - Molecular Biology 2021Quote: MCF-7 cells were maintained in RPMI media (11875093, Invitrogen) and MDA-MB-231 and 293T in DMEM media (MT10013CV ...
-
bioRxiv - Cell Biology 2020Quote: ... BMDC were differentiated for 7 days in RPMI (Life technologies) containing 10% v/v heat-inactivated foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... yeast cells were labeled with 7-Aminochloromethylcoumarin (CMAC; Life Technologies) at a concentration of 100 μM for 30 min in synthetic medium at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... on a Viia 7 Real-Time PCR System (ThermoFisher Scientific). The relative quantification of target mRNAs was performed using the LinRegPCR method [87] ...
-
bioRxiv - Cancer Biology 2022Quote: ... on the ViiA 7 Real-Time PCR System (Life technologies). Hprt ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplification was monitored on a QuantStudio™-7 (ThermoFisher Scientific) with cycle conditions consisting of enzyme activation (predenaturation ...
-
bioRxiv - Developmental Biology 2022Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). qRT-PCR Primers (targeting human genes unless otherwise noted):
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was run on a QuantStudio 7 Flex (Applied Biosystems) using 40ng cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... in a Viia 7 Real Time PCR System (Applied Biosystems). The following cycle conditions were used ...
-
bioRxiv - Immunology 2022Quote: ... in the ViiA 7 Real-Time PCR system (Applied Biosystems). The following TaqMan probes (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: COS-7 cells were transfected using Lipofectamine RNAiMAX (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... staining or Annexin V-Pacific Blue/7-AAD (Invitrogen/eBioscience) staining followed by fluorescent activated cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Amplification was performed on QuantStudio 7 Flex® (Applied Biosystems). Beta-actin was used as an endogenous control for normalisation of target genes ...
-
bioRxiv - Immunology 2020Quote: ... in a ViiA 7 Real-Time PCR system (Applied Biosystems). The relative expression of target genes was confirmed using the quantity of target gene/quantity of GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). The copy number for each transcript is expressed relative to that of housekeeping gene HPRT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7 ppm (v/v) β-mercaptoethanol (Life Technologies, 21985-023), 4 ng/mL bFGF (Peprotech ...
-
bioRxiv - Immunology 2022Quote: ... and IL-13 (Alexa Fluor 488, or PeCyanine 7, Invitrogen; or eFluor 660 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Granzyme B (effector T cells, GRB-7, Thermo Fisher Scientific), CD68 (macrophages ...
-
bioRxiv - Immunology 2020Quote: ... or Annexin V cell apoptosis kit with 7-AAD (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Analysis was performed with ViiA™ 7 Software (Thermo Fisher). The fold change gene expression in the fetal corneas at 9 wg ...
-
bioRxiv - Microbiology 2020Quote: ... and run on a QuantStudio 7 Flex instrument (Applied Biosystems) under the following cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... using the ViiA-7 Real-Time PCR system (Applied Biosystems), and the expression levels were normalized to GAPDH.
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Physiology 2021Quote: ... in the ViiA 7 Real-Team PCR System (Thermo Fisher) with the following times ...
-
bioRxiv - Physiology 2020Quote: ... 7-AAD or fixable viability dye eFluor780 (Thermo Fisher Scientific) served as a live-dead stain ...