Labshake search
Citations for Thermo Fisher :
5901 - 5950 of 10000+ citations for Biotin Z Antibody Internalization Kit rabbit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubating with a donkey anti-rabbit secondary antibody conjugated with the green Alexa Fluor 488 (diluted at 1:400; Invitrogen), for 3 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were rinsed three times in 1X PBS and incubated at room temperature for two hours with Alexa fluor 594 conjugated secondary antibodies (1:10,000 dilution; donkey anti-rabbit, A21207, RRID: AB_141637, Invitrogen, Waltham, MA). Sections were mounted on super frost plus slides (Catalog # 12-550-15 ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed extensively in TBS before being incubated with biotinylated goat anti-rabbit IgG (H+L) secondary antibody (ThermoFisher Cat# B-2770 ...
-
bioRxiv - Neuroscience 2024Quote: ... Secondary antibodies included goat anti-rabbit conjugated with Alexa 564 and goat anti-mouse conjugated with Alexa 647 (Molecular Probes). After mounting ...
-
bioRxiv - Molecular Biology 2024Quote: ... Uterine samples were then washed in PBST for 15 minutes twice and 45 minutes four times then incubated with fluorescently conjugated Alexa Fluor 555 Donkey anti-Rabbit IgG secondary antibody (A31572, Invitrogen), and 647 Goat anti-Rat secondary antibody (A21247 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with the secondary antibody diluted in PBS (goat anti-rabbit conjugated to Alexa Fluor 568, Life Technologies, A11004 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 h incubation with goat anti-rabbit IgG Alexa Fluor 546 secondary antibody (1:500, Life Technologies, Carlsbad, California, USA) were performed ...
-
bioRxiv - Bioengineering 2024Quote: ... Alexa Fluor 488 and goat anti-rabbit IgG (H + L) Alexa Fluor 647 secondary antibodies (1:200 in PBS; Cat. Nos. A11017 and A21245, Invitrogen) for 3 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 2 hrs at RT and incubated overnight at 4°C in primary antibody solution (1:100 rabbit anti-GFP (ThermoFisher) in blocking reagent) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The membranes were then treated with secondary antibodies (biotinylated goat anti-rabbit IgG (#65-6140, Invitrogen, Rockford, IL, United States), biotinylated goat anti-rat IgG (#405428 ...
-
bioRxiv - Bioengineering 2024Quote: ... Then secondary antibodies were then added in blocking buffer over night at 4 ºC (Goat anti Rabbit 647, Thermo Fisher Scientific A21245 ...
-
bioRxiv - Pathology 2024Quote: ... The primary antibodies were then visualized using secondary antibodies conjugated with the appropriate listed fluorophores: goat anti-rabbit IgG Alexa Fluor 568 (Invitrogen, A-11011 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by incubation with the secondary antibody (Alexa Fluor® 555-conjugated anti-rabbit IgG (Thermo Fisher Scientific, USA; #A21429)) and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2024Quote: ... Colon tissue sections were prepared for immunofluorescence staining as previously described [27] using goat anti-human-AF647 and rabbit anti-GFP-AF488 conjugated antibodies (ThermoFisher, Invitrogen).
-
bioRxiv - Immunology 2024Quote: ... The samples were washed twice with TBS and incubated for 1 h at room temperature with the following antibodies: anti-rabbit Alexa Fluor plus 595 (1:1,000, cat. A-11012, Thermo Fisher), anti-mouse CD8-APC (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Appropriate secondary antibodies were used (1:500, goat anti-rat Alexa 488 Invitrogen A11006; 1:500, goat anti-rabbit Alexa 555 Invitrogen A21429 ...
-
bioRxiv - Neuroscience 2024Quote: ... then incubated with secondary antibodies (1:500 Alexa488 donkey anti-goat, A11055, ThermoFisher, Waltham, MA, USA; 1:500 Alexa594 donkey anti-rabbit, A21207, ThermoFisher) in 10% NDS and 0.3% Triton-X in 0.1M PBS for four hours ...
-
bioRxiv - Neuroscience 2024Quote: ... and then incubated with fluorescently labeled secondary antibodies (1:1000, Alexa594 Goat anti-Rabbit IgG, Thermo Fisher Scientific Inc., #A11037) in 1% normal goat serum in PBS containing Hoechst 33342 (1:1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following secondary fluorescent antibody incubation (Donkey anti-mouse conjugated Alexa Fluor 568, Donkey anti-Rabbit conjugated Alexa Fluor 488 or 647, Invitrogen), nuclei were stained with DAPI dye (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were washed 3× 5min with 1×PBST and incubated with mouse or rabbit secondary antibodies conjugated with horseradish peroxidase (Invitrogen) for 1 h at room temperature followed 3 × 5 min wash by 1× PBST ...
-
bioRxiv - Immunology 2020Quote: ... The purified antibody was conjugated to AlexaFuro647 with microscale protein labeling kit (Invitrogen A30009). For the cross-reactivity assay ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated with primary antibodies (Anti-OxPhos Complex Kit (Life technologies, cat. no. 457999) and Anti-MTCO1 antibody (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... AbC™ Total Antibody Compensation Bead Kit (catalog # A10513) was purchased from Thermo Fisher Scientific and used for validating all the antibodies and generating signal spillover table (Supplementary Table 3).
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorescently labeled wild-type PCSK9 was prepared using the DyLight800 Antibody Labeling Kit (ThermoFisher) as per manufacturer’s instructions followed by gel filtration chromatography on a Superdex 200 10/300 GL column (GE Healthcare ...
-
bioRxiv - Cell Biology 2019Quote: Anti-Ii for live immunostaining was labelled using Monoclonal antibody labeling kit (Molecular Probes) according to manufacturer’s protocol with AlexaFluor™-488 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The anti-SMA antibody was directly labeled using Zenon direct labeling kit (Invitrogen/ThermoScientific) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... AbC total antibody and amine reactive ArC compensation beads kits (ThermoFisher, A10497 and A10346) were included for single stain controls ...
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies were captured with magnetic beads (Pierce Classic Magnetic IP Kit, Thermo Scientific, #88804) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... primary antibodies were conjugated to Alexa Fluor with the Zenon labelling kits (Thermofisher Scientific). Cells were then incubated with DAPI (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... These antibodies were expressed using the Expi293 expression system kit (Cat# A14635, Thermo Fisher) with human IgG1 constant regions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody-independent Vybrant Phagocytosis Assay Kit was used per manufacturer instruction (Invitrogen, V6694).
-
bioRxiv - Microbiology 2023Quote: ... or no protein in 200 µl antibody binding and washing buffer (Invitrogen kit 10006D) for one hour at RT ...
-
bioRxiv - Neuroscience 2024Quote: Antibody was immobilized on columns using an Aminolink kit (Thermofisher #44890, Waltham, MA, USA) per manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: ... IgG was purified from the rabbit serum using a Melon Gel IgG Spin Purification Kit (Thermo Fisher Scientific) and then used for immunohistochemistry.
-
bioRxiv - Cell Biology 2021Quote: ... Anti-SUMO2/3 antibody (MBL) was labelled with Alexa Fluor® 594 using an Alexa Fluor™ 594 Antibody Labeling Kit (Invitrogen-ThermoFischer) and diluted to 1/200 in Can-Get-SignalTM Immunostain solutions (TOYOBO) ...
-
bioRxiv - Genetics 2023Quote: ... goat α rabbit Cy3 or donkey α rabbit Alexa488 (ThermoFisher). Neuronal membranes were visualized with 1:100 goat α HRP-Alexa 647 (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2021Quote: ... in the presence of 1/5 biotin-16-dUTP (JenaBioscience, NU-803-BIO16-L) to dTTP (ThermoFisher, 10520651). The PCR was done with primer CD21 (GACCGAGATAGGGTTGAGTG ...
-
bioRxiv - Biophysics 2019Quote: ... in minimal media (1% glycerol, 100 mM potassium phosphate pH 6.0, 0.4 mg L-1 biotin, 1X YNB from Invitrogen) supplemented with 1 mg mL-1 zeocin and cultured in shaker flask for 2 days at 29°C ...
-
bioRxiv - Genomics 2021Quote: ... Biotin-labeled DNA was purified by incubation with 100µl Dynabeads MyOne Streptavidin C1 beads (Thermal Fisher Scientific, 65002) at RT for 15min ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.5 in 1X PBS then treated with 400 μg/ml sulfo-N-hydroxysulfosuccinimide-biotin (Thermo Fisher Scientific) prepared in the washing buffer for 40 min on an orbital shaker at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4) and incubated with 0.5 mg ml−1 sulfo-NHS-LC-biotin (EZ-Link, Pierce/Thermo Scientific) in PBS2+ while shaking for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... αCT1 eluted from cross-linking reactions was detected on blots against biotin with HRP-NeutrAvidin (ThermoFisher, 31001, MA). Signals were detected by HR-based chemiluminescence (ThermoFisher ...
-
bioRxiv - Biophysics 2019Quote: ... Nick translation was initiated by the addition of 5 µl of 250 µM biotin-11-dUTP (ThermoFisher Scientific) and 1.5 U of E.coli DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10mM EDTA) and 20% EZ-Link Biotin-HPDP (1 mg/mL resuspended in DMF, Thermo Fisher Scientific, 21341) for 1.5 hours at 800 rpm and 24°C in the dark ...
-
bioRxiv - Molecular Biology 2019Quote: ... We added 52 µL of incorporation master mix: 37.5 µL of 0.4 mM biotin–dATP (Thermo Fisher, 19524016); 4.5 µL of a dCTP ...
-
bioRxiv - Cell Biology 2019Quote: ... in PBS was incubated with 86.1μl of Sulfo-NHS-SS-Biotin (sulfosuccinimidyl-20(biotinamido)ethyl-1,3-dithiopropionate) (8mM) (Thermo Scientific) for 2 hrs at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Surface proteins were labelled with EZ-Link Sulfo-NHS-LC-Biotin (Thermo Scientific, 0.3 mg/ml in PBS) at 4 °C for 30 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A small amount of the purified proteins were biotinylated using the EZ-link BMCC-biotin system (ThermoFisher Scientific). ≈1 mg BMCC-biotin was dissolved directly in 100% DMSO to a concentration of 8 mM for labeling ...
-
bioRxiv - Physiology 2020Quote: ... cells were incubated with the cleavable EZ-Link Sulfo-NHS-SS-Biotin (0.5 mg/ml, Thermo Fisher Scientific) in ice-cold PBS (pH 7.4 ...
-
bioRxiv - Cell Biology 2021Quote: ... or 5 µl of EZ-Link™ Sulfo-NHS-Biotin (21217, Thermo Fisher Scientific, 1 µg/20 µl), while still attached via the umbilical cord to the mother’s blood circulation ...