Labshake search
Citations for Thermo Fisher :
5651 - 5700 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: F-actin was labeled with N-(1-pyrene) iodoacetamide (PIA) (Invitrogen, Thermo Fisher Scientific, Waltham, MA) essentially as described previously (17,20) ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue or cells were lysed in N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease and phosphatase inhibitor cocktail (#78440 ...
-
bioRxiv - Microbiology 2021Quote: ... All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher), grown to an OD600 of 0.8 in LB media ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue or cells were lysed using N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease inhibitor cocktail (#5871S ...
-
bioRxiv - Microbiology 2021Quote: ... and 25 ng linear pPolI-SARS-CoV2-NLuc-N plasmid using 2μl of Lipofectamine 2000 (Invitrogen) to a DNA:lipofectamine ratio of 1:3 and 100μl Opti-MEM (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... The N-based assay used a standard curve synthesized as follows: T7 in vitro transcription (ThermoFisher) of a synthetically produced N sequence (IDT ...
-
bioRxiv - Physiology 2021Quote: ... homogenized individually (N = 30 per condition and per independent experiment) in 500 μl of TRIzol (Invitrogen) and stored at −80°C until RNA extraction.
-
bioRxiv - Cell Biology 2020Quote: ... the N-terminal His6-tag was removed by the addition of His6-rTEV protease (Life Technologies) and dialyzed in H Buffer for 36 h at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Neuroscience 2022Quote: ... compound and sectioned into six series of 40μm coronal sections (Microm HM N°560, Thermo Scientific) into 1xPBS containing 0.1% sodium azide ...
-
bioRxiv - Microbiology 2020Quote: ... Amersham Hybond-N+ nylon and Amercham Hybon-XL nitrocellulose membaranes were purchased from ThermoFisher (Illkirch, France).
-
bioRxiv - Microbiology 2020Quote: ... the sequence of the plasmid EGFP-N was confirmed by sequencing (Gene Art–Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The hiPSCs were maintained on vitronectin (VTN-N; cat. num. A14700; Thermo Fisher Scientific, Waltham, MA)-coated plates in Essential 8 Flex medium (E8 ...
-
bioRxiv - Microbiology 2022Quote: ... The online desalting column (trap column) used was a C18 column (Thermo Scientific P/N 160454). At 4.6 min the flow from the nano pump was diverted to the trap column in a backward flush direction ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from liver tissues (n=4-5 mice/group) using Trizol (ThermoFisher Scientific). Concentration was measured by nanodrop (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: Proteins were extracted from iPSC using N-PER™ Neuronal Protein Extraction Reagent (Thermo Fisher Scientific) supplemented with protease (cOmplete™ Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase I digestion was stopped by adding 10U of Superase Inhibitor (Thermo Scientific, cat. n° AM2696) for 10 min on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Validation of second strand synthesis was performed by Nuclease S1 digestion (Thermo Fisher, cat n°EN0321) according to manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... After the final wash cells were resuspended in PBS with 1% BSA (ThermoFisher, Cat. N: AM2618) and the cell number as well as viability were assessed using Countess™ II Automated Cell Counter (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... the N and ORF1ab were detected using FAM and VIC labelled Taqman probe by Applied Biosystems™ 7500 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies were raised against a peptide containing an N-terminally derived sequence (ERQTQSSLEDSDDQFGDPR, Thermo Fisher, USA) (1:500 dilution of serum) ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were extracted from iPSC using N-PER™ Neuronal Protein Extraction Reagent (Thermo Fisher Scientific) supplemented with protease (cOmplete™ Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Bioengineering 2022Quote: ... and Mack2 P3 (n = 1)) was purified using GeneJET Genomic DNA Purification Kits (ThermoFisher Scientific #K0721). In an adapted method from Aranishi19 ...
-
bioRxiv - Bioengineering 2022Quote: ... and sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (sulfo-SMCC) were purchased from Thermo Scientific (USA). Human BDNF ...
-
bioRxiv - Immunology 2022Quote: ... NLRP1 knockout N/TERT-1 keratinocytes were prepared by using the Neon Transfection System (ThermoFisher Scientific) following the manufacturer’s recommendations to deliver Cas9 ribonucleoprotein complexes containing an Alt-R CRISPR-Cas9 sgRNA and recombinant Cas9 (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... NLRP1 knockout N/TERT-1 keratinocytes were prepared by using the Neon Transfection System (ThermoFisher Scientific) following the manufacturer’s recommendations to deliver Cas9 ribonucleoprotein complexes containing an Alt-R CRISPR-Cas9 sgRNA and recombinant Cas9 (IDT) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were plated on 62 Q-trays (Nunc™ Square BioAssay Dishes product n. 240835, ThermoFisher) each containing 200 mL of 2xPY medium (16 g/L peptone ...
-
bioRxiv - Molecular Biology 2022Quote: ... and MMP (n=60; minimum of 20 per group) with MitoTracker® Red CMXRos (Thermo Fisher). After IVM ...
-
bioRxiv - Molecular Biology 2022Quote: ... and MMP (n=60; minimum of 20 per group) with MitoTracker® Red CMXRos (Thermo Fisher). COCs from all groups were transferred to a 50 μL drop of PBS containing CRG (5μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... HDFn iPS cells were maintained in a feeder-free system on vitronectin (VTN-N; Gibco; A31804) coated tissue culture plastics in Essential 8 Flex medium (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleus were stained for 5 min with Hoechst n°33342 (ref H3570, Invitrogen, Carlsbad, California, USA) at 1:2000 ...
-
bioRxiv - Biochemistry 2024Quote: ... and fractionated using high pH reversed-phase peptide fractionation kits (Thermo Fisher Scientific, P/N 84868) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and inserted into a pET-SUMO expression vector containing an N-terminal hexahistidine-SUMO tag (Invitrogen). PARP1 truncations (PARP1-ZnF ...
-
bioRxiv - Plant Biology 2024Quote: ... Nitrogen (N) and carbon (C) contents were determined using an elemental analyzer (Thermoflash 2000; Thermo Scientific).
-
bioRxiv - Microbiology 2023Quote: ... qPCR reactions were performed using the TaqMan Environmental PCR Master Mix (Applied Biosystems, Part n° 4396838) with an amplicon size of 81 base pairs and the following forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... SK-N-SH cells were reverse-transfected with 20 nM of siRNA using Lipofectamine RNAiMAX (Invitrogen) in collagen-coated 96-well plates and then cultured for 60 h ...
-
bioRxiv - Bioengineering 2023Quote: ... and then incubated with N-γ-maleimidobutyryl-oxysuccinimide ester (1mM in absolute ethanol, Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Biophysics 2023Quote: Human neuroblastoma cell line (SK-N-BE) stored at -80°C in freezing medium (RPMI Gibco® supplemented with 20% FBS Gibco and 10% DMSO) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 to 50mg of tissue was ground in N-PER lysis buffer (ThermoFisher Product No. 23225) with protease and phosphatase inhibitors (cOmpleteTM Protease Inhibitor Cocktail 11697498001 ...
-
bioRxiv - Biochemistry 2022Quote: ... These SCX fractions (n=7) were cleaned up using C18 spin columns (89870, Pierce, ThermoFisher, USA), dried using SpeedVac at 40 °C and resuspended in formic acid (0.1 % ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleus were stained for 5 min with Hoechst n°33342 (ref H3570, Invitrogen, Carlsbad, California, USA) at 1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... washed once with preheated (37°C) Dulbecco’s Phosphate Buffered Saline (DPBS) (Gibco; cat n° 14190-144), re-spun and resuspended in pre-heated DMEM without serum.
-
bioRxiv - Cell Biology 2023Quote: ... The negative control siRNA was Silencer™ Select negative control N° 2 (cat# 4390846, Thermo Fisher).
-
bioRxiv - Bioengineering 2023Quote: ... The mixture of extracted blood was mixed with 5 μL of 10 mM N-ethylmaleimide (ThermoFisher) in DPBS following previous methods for arresting cellular metabolic activity.39
-
bioRxiv - Bioengineering 2023Quote: ... N′-Tetramethylethylenediamine (TEMED, 4 μL/ mL of precursor solution, Thermo Fisher Scientific Cat No. J63734.AC) were added to the solution followed by vortexing ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA quantity was determined using a QubitTM 1X dsDNA HS Assay Kits (ThermoFisher, cat. n. Q33230), and DNA quality was assessed using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The solution mixture containing cDNA products was neutralized with 1.5 µL 1 N HCl (Fisher Scientific). To separate cDNA products by capillary electrophoresis ...
-
bioRxiv - Biochemistry 2024Quote: ... Stable cell line 293T-N was selected and cultured under 1 µg/ml puromycin (Gibco, A1113802). Monoclonal population of the 293T-N was isolated using limiting dilution method ...
-
bioRxiv - Biochemistry 2024Quote: ... The modified nucleosomes were then conjugated with PEAS [N-((2-pyridyldithio)ethyl)-4- azidosalicylamide] (Thermo Fisher), iodinated with [125I] and bound to saturating concentrations of WT or mutant Arp5 complexes ...