Labshake search
Citations for Thermo Fisher :
5501 - 5550 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of glutathione magnetic agarose beads (Pierce Glutathione Magnetic Agarose Beads, Thermo Fisher) were equilibrated with wash buffer (100 mM sodium phosphate pH 7.2 ...
-
bioRxiv - Immunology 2023Quote: ... Cells were resuspended in 5 µl ProLong™ Diamond Antifade Mountant solution (Thermo Fisher). The mounting solution containing stained yeast or hyphae was transferred to glass slides and covered with a coverslip ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with 5 µg/ml NeutrAvidin (Thermo Fisher Scientific), then blocked in PBS containing 1% BSA for 1 hour at room temperature (RT) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated in blocking buffer (5% goat serum (Gibco, ThermoFisher Scientific, Waltham, MA) in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... containing 5 µL Fast SYBR Green Master Mix (Applied Biosystems by Thermo Fisher Scientific), 500 nM reverse and forward primers designed to amplify 80–120 bp of the genes of interest ...
-
bioRxiv - Plant Biology 2023Quote: ... containing 5 µL Fast SYBR Green Master Mix (Applied Biosystems by Thermo Fisher Scientific), 500 nM reverse and forward primers designed to amplify 80–120 bp of the genes of interest ...
-
bioRxiv - Molecular Biology 2023Quote: ... in PBS for 45 min and 1% formaldehyde for 5 min (Thermo Scientific 28908). The reaction was quenched with 0.125 M glycine ...
-
bioRxiv - Pathology 2023Quote: The cDNA was then diluted by 1:5 in nuclease-free water (#10526945, ThermoFisher). qPCR was performed using 2x PCRBIO Sygreen Blue Mix Hi-ROX (#PB20.16-20 ...
-
bioRxiv - Immunology 2023Quote: ... and bound fractions were eluted with 5× Lane Marker Reducing Sample Buffer (Thermo Fisher). For detection of biotynilated DNA in the IP products ...
-
bioRxiv - Neuroscience 2023Quote: ... immunoblotted with anti-ubiquitin antibody 1:500 in 5% BSA TBST (13-1600, Invitrogen) and reprobed with anti-C-cadherin antibody 1:100 in 5% non-fat milk TBST (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts of cDNA and 5 μL of SYBR green master mix (Thermo Scientific). qPCR was performed on a Lightcycler 480 ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed with 5 µL 2x SYBR Green PCR Master mix (Applied Biosystems), 1 µL ChIP DNA ...
-
bioRxiv - Microbiology 2023Quote: ... and were cultured at 37°C and 5% CO2 in RPMI-1640 medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... aspiration of supernatant and resuspension in 5× Lane Marker Reducing Sample Buffer (Thermo Fisher). Samples were then subjected to SDS-PAGE followed by immunoblot analysis with the indicated antibodies ...
-
bioRxiv - Immunology 2023Quote: ... The resin was then treated with 5× Lane Marker Reducing Sample Buffer (Thermo Fisher). To generate the Triton X-100-soluble and -insoluble fractions ...
-
bioRxiv - Immunology 2023Quote: ... and bound fractions were eluted with 5× Lane Marker Reducing Sample Buffer (Thermo Fisher). For detection of BrdU ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... cells were incubated for 5 minutes with CellMask orange (1:40000, Thermo Fisher Scientific) and 5 minutes with SPY650 (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... 5 ug of plasmid DNA were placed in 250 μL OptiMEM media (Gibco, 31985062), then 7.5 μL of transit-LTI reagent was added to DNA/OptiMEM solution ...
-
bioRxiv - Immunology 2023Quote: ... cells were stained with 5 μM of mitoSOX mitochondrial indicator (Thermo Fisher Scientific, #M36008) for 10 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both DsiRNAs against FANCM were mixed with 5 μL Lipofectamine RNAiMAX (ThermoFisher cat #: 13778150) and 500 μL Opti-MEM so that the total final concentration of RNA in media would be 40 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cy-2- or Cy-5-conjugated goat anti-mouse secondary antibodies (Thermo Fisher Scientific) were used at a 1:750 dilution in 5% HIGS/PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti6/V5-Flag-USP39 infected cells were selected with 5 μg/ml blasticidin (Gibco) while pLL3.7-shRNA infected cells were selected with 2μg/ml puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... eBioscience anti-mouse CD4 PE-Cy7 clone: RM4-5 (Ref # 25-0042-82, Invitrogen), PE anti-mouse CD8a (Ly-2)(53-6.7 ...
-
bioRxiv - Genomics 2022Quote: ... groin and gut were taken and streaked on 5% horse blood agar (Thermo Fisher), prior to incubation at 37 °C for 24 hours and final identification of coagulase-negative Staphylococci after sub-culture on mannitol-salt agar (Oxoid ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-Keratin 5 (1:200; clone EP1601Y; MA5-14473; RRID:AB_10979451; Thermo Fisher Scientific), rabbit anti-SFTPC (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged for 5 mins at 300xg and counted using trypan blue (Thermo Fisher Scientific). 200,000 cells/well were resuspended in E8 containing 10 μM Y27632 ROCK inhibitor (Selleckchem ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was replaced with fresh medium containing 5 μg/ml blasticidin (ThermoFisher Scientific) and the cells were cultured for 10 days ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (ThermoFisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 230C ...
-
bioRxiv - Developmental Biology 2023Quote: 5’-RACE assay was performed using the First Choice RLM-RACE kit (Thermo Scientific) following manufacture’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: Samples (5 µL) were chromatographically separated using an RSLCnano system (Ultimate 3000, Thermo Scientific) coupled online to an Orbitrap Eclipse mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Oligonucleotide probes were synthesized and labeled with biotin at the 5′ end by Invitrogen. The EMSA was performed using a Chemiluminescent EMSA kit (Beyotime ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... muscles were injected with 5 µM Fluo-4 penta-potassium salt (ThermoFisher Scientific, USA) as previously described and viewed with DIC optics on a Nikon Eclipse TE300 inverted light microscope (400× ...
-
bioRxiv - Genetics 2023Quote: ... 2×10^5 individualized iPSCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 nuclease +sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... per 5 x 104 hiPSC-CMs using Lipofectamine 3000 transfection agent (Cat. L3000001, ThermoFisher) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... then they were incubated for 2 h in 5% normal donkey serum (NDS, Gibco), 0.2% Triton-X100 in PBS to block nonspecific binding ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections of 4-5 μm were cut using a rotary microtome (HM355S, Thermo Scientific). Sections were deparaffinized in xylene and rehydrated in a descending series of ethanol (96%–50% ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged at 1000 rpm for 5 min and washed with 1X cold PBS (Gibco). The resulting pellet was suspended with 1X Annexin binding buffer (Becton Dickinson) ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were blocked in the blocking buffer – 5% BSA (Thermo Fisher Scientific, #BP9704100) in PBST (PBS with 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... Cultures were incubated (37 °C; 5% CO2) in a medium consisting of MEM (Invitrogen), supplemented with 35 mM Glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% FBS and 1% penicillin-streptomycin (all from Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... and cultured at 37°C and 5% CO2 in RPMI 1640 medium (Life Technologies) supplemented with 10% HIFBS (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... synchronized HCFs were harvested and stained with 5 µM CellTrace™ CFSE (C34570, Invitrogen) in PBS for 20 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were blocked with 5% normal goat serum (NGS) (Thermofisher Scientific, Cat# 31872) for 1 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: Total RNA (5 µg) from each yeast transformant was treated with TURBO DNase (Invitrogen) by adding 1 µl of the enzyme ...
-
bioRxiv - Microbiology 2024Quote: ... After 4–5 days of culture in the Expi293 Expression Medium (Thermo Fisher Scientific), supernatants were collected and passed through a 0.22-µm filter ...
-
bioRxiv - Physiology 2024Quote: ... The cardiomyocytes were finally plated onto laminin-coated coverslips (5 μg/ml, Thermo Scientific) and cultured in the M-199 medium supplemented with bovine serum albumin (BSA ...