Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for tert Butyl 3 5 2 amino ethyl thiophen 3 yl propionate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and were passaged every 2 or 3 days using 0.05% Trypsin (Gibco). mESCs were used at passages below 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fibroblasts were fed every 2-3 days with DMEM (ThermoFisher Scientific, #11995073) media supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were passaged once every 2-3 days by trypsinization (Gibco, 25300054) upon reaching ∼70-80% confluency ...
-
bioRxiv - Physiology 2020Quote: ... for 3 days with macrophage-conditioned medium containing 2% Horse Serum (Gibco). Cells were washed ...
-
bioRxiv - Cell Biology 2020Quote: ... spiked with 2-3 μL Plus reagent (15338100, Thermo Fisher Scientific, USA). The plasmid solution was mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were split every 2 to 3 days using TrypLE Express (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Pathology 2022Quote: ... 2 and 3 were quantified using CyQUANT Proliferation Assay Kit (Invitrogen, C35011); For myofibroblast differentiation assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
bioRxiv - Genetics 2024Quote: ... transfected cells were selected using 2-3 µg puromycin (Thermo Fisher Scientific) until all cells in non-transfected control were dead ...
-
bioRxiv - Neuroscience 2024Quote: ... This medium was exchanged 2-3 hours after plating with Neurobasal (Gibco) supplemented with L-glutamine (2 mM) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-Nitrobenz Oxadiazol Amino Deoxyglucose (2-NBDG, Invitrogen, Cat# N13195) for 30 minutes (figure 4(a)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% non-essential amino acids (Thermo Fisher), 2% chemically defined lipids (Thermo Fisher) ...
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), and 1mM sodium pyruvate (Gibco).
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), 1 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% MEM Essential Amino Acids (ThermoFisher Scientific), 2% B27 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2% MEM amino acid solutions (Gibco, 11140050) and 1mM Sodium pyruvate (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed 3×5 min in PBS and incubated for 2 h with an Alexa Fluor® Plus 555-conjugated secondary antibody (Invitrogen A32816) diluted in the blocking solution ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Bioengineering 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass, 3 µg total plasmid) using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). Media was exchanged after 6 hours and viral supernatant was harvested 48 hours after transfection and filtered through 0.45 μm cellulose-acetate filters (VWR cat ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Microbiology 2021Quote: ... and cells were incubated for 3 hours in minimal essential medium (MEM, Life Technology, Catalog # 11095114) supplemented with 1x MEM non-essential amino acids (Gibco) and 1x Antibiotic/Actinomycotic cocktail (Life Technology) ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Cell Biology 2024Quote: ... A new rabbit serum was raised against mouse ninein, by cloning cDNA encoding mouse ninein (Uniprot Q61043-3, amino acids 1-496) into vector pRSET-A (Invitrogen), to produce a fusion protein with an amino-terminal hexa-histidine-tag ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).