Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Quantitative real-time PCR was performed using a StepOne™ sequence detection system (Applied Biosystems, USA), with 10 ng cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCRs were performed using the ABI 7700 sequence detection system and software (Applied Biosystems). All primer sequences are available upon request.
-
bioRxiv - Developmental Biology 2020Quote: ... Detection was performed using a QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher Scientific). Reactions were carried out in a 384-well plate ...
-
bioRxiv - Developmental Biology 2022Quote: ... Analysis was performed using the ABI Prism HT 7900 real time PCR detection system (Applied Biosystems) equipped with SDS software version 2.4 (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Thermal cycling and fluorescence detection were performed using the ViiA 7 real-time PCR system (ThermoFisher) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time qPCR was performed using QuantStudio 5 Real-Time PCR System (ThermoFisher) and PowerUp SYBR™ green master mix ...
-
bioRxiv - Developmental Biology 2021Quote: Quantitative real-time RT-PCR was performed using an ABI Prism 7500 Fast SDS (Applied Biosystems). Total RNA was extracted using NucleoSpin RNAII kit (Takara ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... and RT-qPCR was performed using SYBR® Green Real-Time PCR Master Mixes (Invitrogen™) and the StepOnePlus Real System (Applied Biosystems™) ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by RT-qPCR on a StepOnePlus Real-Time PCR System (Applied Biosystems) using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RT-qPCR reaction was also performed using the StepOne real-time PCR system (Applied Biosystems) with the KOD SYBR qPCR Mix (Toyobo Co ...
-
bioRxiv - Plant Biology 2021Quote: ... The RT-qPCR were performed in the QuantStudio® 3 Real-Time PCR System (Applied Biosystems) using the SYBR® Green detection system ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time RT-PCR was performed in a StepOne plus system (ABI StepOne Plus, ThermoFisher, USA) using SYBR green master mix (cat ...
-
bioRxiv - Genomics 2021Quote: ... SARS-CoV-2 RT-qPCR was performed in a 7500 Real-Time PCR System (Applied Biosystems) using Seegene-Allplex 2019-nCoV Assay ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time RT-PCR was conducted with TaqPath 1-Step Multiplex Master Mix (ThermoFisher Scientific, USA) and total RNA isolated by TRIzol LS reagent from individual oral swabs and feces samples.
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed on the 7500 Fast or StepOnePlus Real-Time PCR System (Thermo Fisher), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was carried out using a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) and KAPA SYBR Fast qPCR reagents (KAPA Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was run in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific 4453545) with cycle settings following manufacturer’s protocols for the RT-qPCR kit ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR reactions were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: RT-qPCR was performed with a StepOnePlus™ Real-Time PCR System (ThermoFisher Scientific, Waltham, MA). Forward and reverse primers ...
-
bioRxiv - Immunology 2023Quote: ... real-time quantitative PCR (RT-qPCR) was performed using TaqMan Fast Advanced Master Mix (Applied Biosystems) and the following primers which were all purchased from Applied Biosystems ...
-
bioRxiv - Pathology 2023Quote: ... RT-qPCR reactions were conducted on the Viia 7 Real-time PCR System (Applied Biosystems, USA) with SYBR Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Neuroscience 2023Quote: RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real-time RT-PCRs were performed in a QuantStudio 7 Flex System (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were performed on QuantStudio 12 K Flex Real-Time PCR System (Applied Biosystems) and analyzed with the QuantStudio 12 K Flex Applied Biosystems software v1.2.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) per manufacturer methods and as previously published49 ...
-
bioRxiv - Cell Biology 2024Quote: ... miR-218-5p and the internal control snRNA U6 was carried out with TaqMan miRNA kits (Thermo Fisher Scientific). All qPCR assays were performed on Rotor-Gene Q thermocycler (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCRs were performed using the AB quantitative real-time PCR system ViiA 7 (Applied Biosystems). Fast SYBR Green master mix (Life ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR reactions were run on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Immunology 2019Quote: ... Library concentrations were determined by real-time PCR with a StepOnePlus Real Time PCR System (Thermo Fisher) and a Kapa Library Quantification Kit (Kapa Biosystems / Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and quantitative real-time PCR (qPCR) was performed on the StepOne Real-Time PCR System (Applied Biosystems). Human GAPDH abundance was used for normalization ...
-
bioRxiv - Immunology 2019Quote: ... Real time PCR analysis was performed using StepOne and QuantStudio 5 Real-Time PCR systems (Applied Biosystems). Hprt ...
-
bioRxiv - Genetics 2019Quote: ... SYBR green real-time PCR cycling conditions using QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific) and amplification efficiency calculation (E=e(−1/slope) ...
-
bioRxiv - Microbiology 2021Quote: ... mRNA was quantified by real-time PCR using a ViiA 7 Real-Time PCR System (Life Technologies), fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed on Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher) using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... and 60°C for 1 min with real-time PCR system (StepOnePlus Real-Time PCR System, ThermoFisher). In the assay ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was performed with the Step One Plus Real-Time PCR System (Applied Biosystems), using iTaq SYBR Green Supermix with ROX(Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed on a real-time PCR system (QuantStudio 6 Flex, Applied Biosystems) with Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR was performed on a real-time PCR system (QuantStudio 6 Flex, Applied Biosystems) with SYBR Green PCR Master Mix (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA yield was assessed using real-time PCR (7500 Fast Real-Time PCR; Life Technologies, Poland). cDNA was amplified in a reaction mixture containing 1 × qPCR Master Mix (A&A Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was completed on a real-time PCR instrument (7500 Fast Real-Time PCR System, Applied Biosystems) with the Applied BiosystemsTM PowerUPTM SYBRTM Green Master Mix from Applied Biosystems using primers P11 and P12 (Table S1).
-
bioRxiv - Biochemistry 2022Quote: ... Real-time PCR was carried out on the QuantStudio 6-flex Real-time PCR System (ThermoFisher Scientific) using SYBR Green FastMix (QuantaBio ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR analysis was performed in a QuantStudio 5 Real-Time PCR System (Applied Biosystems). Primers and TaqMan probes were as follows ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCR was performed using the StepOne Real-Time PCR system (Thermo Fisher Scientific Inc., USA) and KAPA SYBR FAST qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2022Quote: ... The real-time PCR was performed on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Reactions were performed in duplicates in a final reaction volume of 20 µL containing 10 µL of Power SYBR Green Master Mix (Applied Biosystems) ...