Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Rat Histidine Rich Glycoprotein HRG ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... rat (Thermo Fisher Scientific Cat# A-21094 ...
-
bioRxiv - Immunology 2022Quote: ... rat (Thermo Fisher), and human (AB serum ...
-
bioRxiv - Immunology 2020Quote: ... rat (Thermo Fisher), and human AB (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rat (ThermoFisher), anti-goat (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... rat (Thermo Fisher), and human (AB serum ...
-
bioRxiv - Microbiology 2023Quote: ... Rat Tail (Gibco). One tube of cryopreserved cells (∼500,000 ...
-
bioRxiv - Immunology 2022Quote: ... Glycoproteins were produced by transient transfection of exponentially growing Freestyle 293-F suspension cells (Thermo Fisher Scientific, Waltham, MA) using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2.16 μg of the vector expressing the VSV-G envelope glycoprotein (pMD2.G) were mixed with OptiMEM (Gibco) to a final volume of 400 μl ...
-
bioRxiv - Biochemistry 2022Quote: ... Glycoproteins were produced by transient transfection of exponentially growing Freestyle 293-F suspension cells (Thermo Fisher Scientific, Waltham, MA) using polyethylenimine (PEI ...
-
bioRxiv - Biochemistry 2020Quote: ... the first exon of HRI was amplified by PCR using primers located within the promoter and first intron (Forward: CTAGCTGCAGCATCGGAGT, Reverse: GAGGCAGACGTTCTTTTCAA) using AccuPrime G-C rich polymerase (Invitrogen). Amplicons were cloned into pGEM-T Easy vector (Promega ...
-
bioRxiv - Genetics 2021Quote: ... The genomic region surrounding the CRISPR/Cas9 target site (741 bp) was PCR amplified using AccuPrime GC-Rich DNA Polymerase (Invitrogen) (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... falciparum cell lines were maintained in human O+ erythrocyte cultures with a 2.5% haematocrit in RPMI 1640 medium supplemented with 0.5% AlbuMAX II Lipid Rich bovine serum albumin (Thermo Fisher Scientific), 25 mM Hepes (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... 5% (v/v) DMSO if the sequence was GC-rich and UltraPure DNase/RNase-free distilled water (Invitrogen; cat # 10977015) to a final volume of 20 μL ...
-
bioRxiv - Immunology 2022Quote: ... ELISA was developed with 50uL TMB (1-Step Ultra TMB-ELISA, Thermo Fisher, Waltham, MA, USA) for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... signals of both ELISAs were visualized using 1-step Ultra TMB ELISA substrate (Fisher Scientific 34028), an incubation period at RT and addition of 2 M sulfuric acid as the stop reagent ...
-
bioRxiv - Immunology 2024Quote: ... Anti-GPI antibody ELISA was conducted by coating ELISA plates (Invitrogen, Cat. No. 44-2404-21) with 50 μl of 10 μg/ml Glucose-6-Phosphate Isomerase (SIGMA ...
-
bioRxiv - Biochemistry 2019Quote: ... pET151/D-TOPO plasmids with the sequences of interest inserted under control of Lac operon and T7 viral promoter with N-terminal hexa-histidine tag and Ampicillin selection marker was obtained from Invitrogen. Sequences were optimized for expression in E ...
-
bioRxiv - Cell Biology 2022Quote: Histidine-tagged Mindin was purified from conditioned media collected from CHO-Mindin cells using Ni-NTA beads (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: The T7 gp5.9 gene from phage T7 was produced as a synthetic gene construct with an N-terminal 3C-cleavable histidine tag (GeneArt, Invitrogen). This was subcloned into the pACEBAC1 (MultiBac ...
-
bioRxiv - Microbiology 2024Quote: ... They were produced with a histidine-tag in the Bac-to-Bac™ Baculovirus Expression System (Invitrogen, for VP3 proteins) or Escherichia coli prokaryotic system (for 2xFYVE) ...
-
bioRxiv - Physiology 2023Quote: ... Total IL-1β protein level was measured by mouse IL-1β/IL-1F2 DuoSet ELISA kit and first normalized to total protein level quantified by Pierce™ BCA Protein Assay Kit (Thermo Scientific), and then normalized to the sham group.
-
bioRxiv - Molecular Biology 2021Quote: ... 96-well ELISA plates (Nunc, Germany) were coated with SARS-CoV-2 specific antigen (S1-RBD at a concentration of 1.5μg/well in PBS pH 7.4) ...
-
bioRxiv - Immunology 2022Quote: MaxiSorp ELISA plates (Thermo Fisher Scientific) were coated with 2 μg/ml purified RBD or S protein in 1xBBS (140 mM NaCl ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... MaxiSorp ELISA plates (Thermo Fisher Scientific) were coated with 10-20µg/ml of anti-mouse immunoglobulin (Ig ...
-
bioRxiv - Microbiology 2022Quote: ... High-binding ELISA plates (Thermo Scientific) were coated with capture antibody and incubated overnight at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... 96 well ELISA plates (Thermo Fisher) were coated with either goat anti-human Ig (10μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plate wells (Thermo Fisher Scientific) were coated with VISTA-Fc (1 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates (NUNC Maxisorp, Thermo Scientific) were coated with 100 μl of recombinant RBD protein or M2e peptide (0.75 μg/ml or 0.5 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... 96-well ELISA plates (Nunc Maxisorp) were coated with 300 ng human IgM (CP initiator ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates (NUNC Maxisorp, Thermo Scientific) were coated with 100 μl of recombinant RBD protein or M2e peptide (0.75 μg/ml or 0.5 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates (NUNC Maxisorp, Thermo Scientific) were coated with 100 µl of M2e peptide or rHA (H1 ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates (NUNC Maxisorp, Thermo Scientific) were coated with 100 µl of M2e peptide or rHA (H1 ...
-
Nanoparticle-delivered TLR4 and RIG-I agonists enhance immune response to SARS-CoV-2 subunit vaccinebioRxiv - Immunology 2022Quote: ... Ultra TMB-ELISA Substrate Solution (ThermoFisher) was incubated for 15 to 25 min for color to develop on the plate ...
-
bioRxiv - Microbiology 2022Quote: ... 96-well ELISA plates (Nunc, Germany) were coated with SARS-CoV-2 specific antigens (S1-RBD at a concentration of 1.5μg/well ...
-
bioRxiv - Microbiology 2020Quote: 96-well ELISA plates (Thermo Fisher) were coated with 1ug of recombinant proteins (20 mM NaHCO3/Na2CO3 ...
-
bioRxiv - Immunology 2020Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL/well of 1 μg/mL recombinant SARS-CoV-2 protein in PBS ...
-
bioRxiv - Immunology 2021Quote: ... 96 well ELISA plates (Thermo Fisher) were coated with goat anti-human Ig (10 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates (NUNC, Thermo Fisher Scientific) were coated with 1 μg MOG35-55 resuspended in coating buffer (0.05M carbonate buffer (pH 9.6) ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates (NUNC, Thermo Fisher Scientific) were coated with 1 μg MOG35-55 resuspended in coating buffer (0.05M carbonate buffer (pH 9.6) ...
-
bioRxiv - Microbiology 2021Quote: ... MaxiSorp ELISA plates (NUNC, Rochester, NY) were coated with 100 ng of recombinant fusion protein (rF1-V ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (MaxiSorp Nunc-immuno plates) were coated with 1 μg/ml of anti-CH3 (MCA878G ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA plates (MaxiSorp Nunc-Immuno plates) were coated with 1 μg/ml recombinant RBD-His protein antigen (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... Streptavidin coated ELISA plates (Thermo Scientific) were incubated with 8 μg/ml G-H loop peptide diluted in PBS at 37°C for 2 hours ...
-
bioRxiv - Immunology 2021Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL per well of 1 μg mL−1 recombinant SARS-CoV-2 protein with the pre-fusion stabilized conformation in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... ELISA plates (Nunc MaxiSorp, ThermoFisher Scientific) were coated with 1 μg/ml recombinant YFV NS1 (Biorad ...
-
bioRxiv - Microbiology 2019Quote: ... ELISA plates (Nunc MaxiSorp, ThermoFisher Scientific) were coated with 1 μg/ml recombinant YFV NS1 (Biorad ...
-
bioRxiv - Immunology 2019Quote: ... or by ELISA (Thermo Fisher Scientific). Cytokine measurement on tissue homogenate was assessed using ELISA (Mouse IFN gamma Uncoated ELISA (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... or by ELISA (Thermo Fisher Scientific). Cytokine measurement on tissue homogenate was assessed using ELISA kits according to the manufacturer instructions (Mouse IFN gamma Uncoated ELISA ...
-
bioRxiv - Neuroscience 2021Quote: ELISA plates (96-well; NUNC, Denmark) were incubated overnight at room temperature with capture antibody (R&D Systems ...
-
bioRxiv - Immunology 2020Quote: ... and human IgG ELISA (Thermo Fisher).