Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Puumala Virus Glycoprotein 2 Gc Human Heterodimeric Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% FCS (Gibco). Peiffier cells were grown in RPMI 1640 medium supplemented with 10% FCS ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% FCS (Gibco) 2 mM glutamine ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 10% FCS (Gibco). THP1 ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 10% FCS (Gibco) and stimulated with plate-bound anti-CD3 (16A9 ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 10% FCS (Gibco), 1% L-glutamate (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 10% FCS (Invitrogen), l-glutamine ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% FCS (GIBCO), 2mML-glutamine ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FCS (Gibco), 1% NEAA (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... containing dialyzed FCS (Gibco, #26400044), penicillin-streptomycin-glutamine (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... with 10% FCS (Life Technologies) and antibiotics (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10 % FCS (Gibco). Cells were routinely tested for mycoplasm contamination.
-
bioRxiv - Immunology 2023Quote: ... 10% heat- inactivated FCS (Gibco), and 50 nM 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 10% FCS (Gibco), 1% penicillin/streptomycin (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 10% FCS (Gibco), 1% penicillin/streptomycin (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% FCS (Invitrogen), 100 IU/ml penicillin ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with 10% FCS (Gibco) and 1% penicillin-streptomycin solution (Sartorius ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 10% FCS (Invitrogen), 100 µg/mL Streptomycin (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10% FCS (Invitrogen, Basel, Switzerland), and penicillin/streptomycin (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10% FCS (Gibco), 1 mM L-glutamine (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 10% heat-inactivated FCS (Gibco), and 50 nM 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Biochemistry 2024Quote: ... FCS (Gibco, 10500, heat inactivated)10% (v/v) ...
-
bioRxiv - Biophysics 2024Quote: ... HEPES (10% FCS) (Gibco, ThermoFisher), supplemented with 1% Penicillin-Streptomycin (PenStrep ...
-
bioRxiv - Biophysics 2024Quote: ... HEPES (10% FCS) (Gibco, ThermoFisher), supplemented with 1% Penicillin-Streptomycin (PenStrep ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with 10% FCS (Gibco) and 1% Pen-Strep in a tissue culture incubator supplied with 5% CO2 at 37°C for 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... 10% FCS (Gibco or Omega) (RP10+) ...
-
bioRxiv - Immunology 2024Quote: ... 10% FCS (Gibco or Omega) (RP10+) ...
-
bioRxiv - Immunology 2024Quote: ... 10% FCS (Gibco or Omega)(DM10+ ...
-
bioRxiv - Microbiology 2020Quote: ... or P1 SARS-CoV-2/München- 1.1/2020/929 (Munich) virus was diluted to 500 µl in 15 ml with virus dilution medium (Opti-MEM, Gibco) supplemented with 2% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Next day cells were washed with phosphate-buffered saline (PBS) and infected with virus in Virus Production Serum Free Media (VPSFM; Gibco) supplemented with 0.25-0.5 ug/mL TPCK-Trypsin ...
-
bioRxiv - Cell Biology 2019Quote: ... Stealth RNAi™ siRNA negative control med GC (Thermo Fisher Scientific) was used.
-
bioRxiv - Microbiology 2019Quote: ... 2.5 μL of GC enhancer (Thermo Fisher Scientific, Carlsbad, California, USA), 2 μL of DNA (1:10 diluted ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were analyzed using a GC Thermo Trace (Thermo Fisher Scientific) equipped with an autosampler (Model HS 2000) ...
-
bioRxiv - Microbiology 2023Quote: ... GC/MS data files were analyzed using Xcalibur software (Thermo Scientific). Sterol composition was calculated from peak areas ...
-
bioRxiv - Plant Biology 2023Quote: ... and injected into a gas chromatograph (Trace 1310 GC, Thermo Scientific) that was equipped with a HP-PLOTQ column (30 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stealth non-silencing Low-GC RNA duplexes (sictl, CGACAAUUGUGAGGUCUAAACUAUU, Life Technologies) were used as non-silencing control.
-
bioRxiv - Developmental Biology 2023Quote: ... The GC was coupled with a MS (ISQ 7000, Thermo Scientific). Injection temperature was 280°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified FAMEs were then analyzed by GC-MS (Thermo Scientific gas chromatograph ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample was then run on a GC-MS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... GC/MS data files were analyzed using Xcalibur software (Thermo Scientific). Sterol composition was calculated from peak areas ...
-
bioRxiv - Immunology 2019Quote: ... and Moloney Murine Leukemia Virus reverse transcriptase (Invitrogen). Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was diluted in infection media (DMEM (Invitrogen) supplemented with 35% BSA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Microbiology 2020Quote: ... and 50% virus solution in RPMI media (Gibco). Mosquitoes were left to feed for 1.5 h using Hemotek membrane feeder system (Discovery Workshops ...
-
bioRxiv - Immunology 2021Quote: ... virus was diluted in RPMI-1640 media (Gibco) and maintained on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... virus was mixed with 4% fast green (Invitrogen) dissolved in saline and injected using a glass micropipette at a rate of 100 nl/min ...
-
bioRxiv - Cancer Biology 2023Quote: ... then virus pellets were suspended in HBSS (Gibco). The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... infected with the Cytotune Sendai virus (Life Technologies) per manufacturer’s protocol to initiate reprogramming ...
-
bioRxiv - Genetics 2024Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus particles were resuspended in Neurobasal A (Invitrogen) and stored at -80 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... these gels were then stained with Periodic acid-Schiff stain using the Pierce Glycoprotein Staining Kit (Thermo Scientific) and Coomassie stained with InstantBlue Protein Stain (Expedeon).