Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Human Metastasis Suppressor KiSS 1 KISS1 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cell pellets were incubated with a 1:200 dilution of human cTnT primary mouse antibody (ThermoFisher) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... cells were stained with a PE-conjugated anti-human IgG1(Fc) secondary antibody (1:50) (ThermoFisher) for additional 15min ...
-
bioRxiv - Neuroscience 2019Quote: ... or 10 μM of freshly prepared human synthetic amyloid-β peptide 1-42 (Aβ42, Life technologies) for 24 h as described (Kiyota et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant human TNF-α a well established trigger of HIV-1 reactivation was purchased from Gibco. The PKC activator Bryostatin and Sodium Butyrate (NaBu ...
-
bioRxiv - Microbiology 2020Quote: The human acute leukemia monocyte cell line (THP-1) was cultivated in RPMI 1640 medium (Invitrogen) supplemented with 10% heat-inactivated FBS (Thermo Scientific Hyclone ...
-
bioRxiv - Biochemistry 2022Quote: ... The ORF of human MYBL2/B-Myb isoform 1 (NM_002466.4) was cloned into pcDNA3.1+ (ThermoFisher Scientific) and fused with an N-terminal Flag tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse-anti-human H3K9/14/18/23/27ac (Thermo Fisher Scientific, Carlsbad, CA, USA; 1:500) was used to detect this histone modification in HPdLF and goat-anti-Mouse-Cy5 (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2021Quote: ... Alexa488- or Rhodamine-conjugated goat anti-human secondary antibody was added (1/500 dilution) (Thermo Fisher), and incubated for 2~3 hr at room temperature in the dark ...
-
bioRxiv - Molecular Biology 2021Quote: ... Immortalized human fibroblasts were cultured in DMEM (sigma) supplemented with 1% of penicillin and streptomycin (Gibco) and 10% fetal bovine serum (Corning ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with goat polyclonal anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific) for 1 hour at RT ...
-
bioRxiv - Immunology 2021Quote: ... plates were incubated with a goat anti-human IgG HRP-conjugate (1/1000; Thermo Fisher Scientific). For IgG subclasses and IgM detection ...
-
bioRxiv - Immunology 2021Quote: Human THP-1 cells (ATCC® TIB-202™) were cultured in RPMI media (22400089, ThermoFisher) supplemented with 1% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:3000 in blocking buffer or HRP-labelled goat anti-human IgM (Thermo Fisher Scientific) diluted 1:4000 at 37°C for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... and 1:5,000 diluted goat anti-human-IgG Fc horseradish peroxidase (HRP) conjugated secondary antibodies (Invitrogen) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD31-APC with human specificity for HUVEC experiments (1:500, Thermo Fisher Scientific, 17-0319-42) together with its IgG1 kappa APC-Isotype control (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng/mL human basic FGF2 (Miltenyi Biotech, 130-093-840) and kanamycin (Gibco, 15160-054). Culture medium was exchanged every 2 days ...
-
bioRxiv - Bioengineering 2023Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-human IgM and IgA (Invitrogen, A18835 and A18781, 1:5,000), rabbit anti-human IgG antibody (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding the ECR of human ADGRB2/BAI2 (aa 1-921) was synthesized by Thermo Fisher GeneArt ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500); Donkey Anti-Mouse IgG H&L Alexa Fluor 647 conjugated (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-Human IgG (H+L) Alexa Fluor 488 conjugated (Invitrogen, A-11013, dilution 1:500). Data acquisition was performed with FACSVerse™ (BD ...
-
bioRxiv - Neuroscience 2024Quote: ... the mean fluorescence intensity (MFI) of Alexa488-coupled goat anti-human IgG (1:500; Life Technologies) was evaluated ...
-
bioRxiv - Cancer Biology 2023Quote: 1 × 105 OCSC1-F2 human OC cells were resuspended in serum-free Opti-MEM (Thermo Scientific) and seeded on trans-well inserts with a polyethylene terephthalate membrane pore size of 8.0 μm (Cat ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then incubated with Alexa 594 goat-anti rabbit secondary antibody at 1:750 and with Alexa Fluor 488 goat anti-human IgG(H+L) at 1:500 (both Invitrogen; in PBS) for 2 h at RT.
-
bioRxiv - Neuroscience 2019Quote: ... iPSCs were cultured on a feeder layer of irradiated mouse embryo fibroblasts using human embryonic stem cell media containing DMEM with F12 (DMEM/F12, 1:1 ratio, Thermo Fisher Scientific) supplemented with 20% Knockout Serum Replacer (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mouse lung fibroblasts (CCL-206, ATCC, Wesel, Germany) or human lung fibroblasts (MRC5, ATCC, CCL-171) were cultured in 1:1 DMEM (Gibco, MD, USA) and Ham’s F12 (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were washed three times with PBS and then incubated with either goat anti-human IgG conjugated with Alexa fluor 488 at a dilution of 1:500 for 1 h (Invitrogen, Carlsbad, CA). The cells were then washed and stained with hoechest-33342 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... 2 million cells were activated with dynabeads human T activator CD3/CD28 at a 1:1 bead to cell ratio (Thermo Fisher Scientific), Staphylococcal enterotoxin B (SEB ...
-
bioRxiv - Immunology 2023Quote: ... highly purified (93-98%) naïve human CD4 T cells were activated using anti-CD3+anti-CD28 Dynabeads (1:1, Thermofisher scientific, cat # 11161D) for 8-24 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used (all at 1:100 dilution in immunofluorescence, 1:1000 in immunoblots): CX36 mouse anti-human (Invitrogen, clone 1E5H5), rabbit recombinant ANTI-FLAG M2 antibody (Invitrogen 710662) ...
-
bioRxiv - Cancer Biology 2024Quote: Primary T-cells (CD4 and CD8; 1:1 ratio) were activated for 24 hours with Dynabeads™ Human T-Expander CD3/CD28 (Thermo Fisher) at 3:1 bead ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...