Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted 1:6 in DMEM/F12 media (11320033, Thermo Fisher, Waltham, USA). The iPSCs were maintained ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:6 once at 70% confluency using Versene (Gibco). Monocyte factories were set up following a previously reported protocol (van Wilgenburg et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then visualised using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) or 4 µM TO-PRO-3 Iodide (TOPRO ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with one of the following secondary antibodies: 1) donkey anti-mouse 488 (1:250; Invitrogen, USA); 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Developmental Biology 2019Quote: ... blastocysts were collected from uterine horns and put on culture for 3-6 days in ES derivation medium composed of GlutaMAX/DMEM (Gibco, 31966), 15% FBS (Biowest) ...
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Systems Biology 2019Quote: A mate-pair library with 3-6 kb fragments was prepared from pure genomic DNA using Ion TrueMate Library Reagents (Life Technologies). The Ion PGM™ template OT2 400 kit (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Embedded tissues were cut into 3-6 µm sections using a paraffin microtome (Leitz) and placed on SuperFrost® Plus slides (Menzel Gläser, Thermo Scientific). Deparaffination and antigen retrieval was done as described previously (Link et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... All 27 samples from 3 groups and 6 GIS were divided and labeled using two sets of 5 mg 11 plex TMT reagents (Thermo Scientific A34808 ...
-
bioRxiv - Immunology 2022Quote: ... and the wells were washed five times with wash buffer before the addition of 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid (ABTS, #37615, Thermo Fisher Scientific). Optical density was read 40 min later at 405 nm using a plate reader (SpectraMax i3 ...
-
bioRxiv - Cell Biology 2021Quote: ... The same amount of protein lysate was aliquoted into different PCR tubes and simultaneously subjected to 6 different temperatures (37, 41, 45, 49, 53, 57 °C) for 3 min in the Veriti Thermal Cycler (Applied Biosystems). After 3 min cooling on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were expanded to 6 × 106/mL the day before transfection and were then diluted to 3 × 106/mL by ExpiCHO™ expression medium (Gibco). Plasmids were diluted to 20 μg/mL by cold OptiPRO medium (Gibco ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was added to cDNA and the DNA was denatured at 95°C for 3 min prior to loading in Novex 6% TBE-urea gel (Thermo Fisher). Samples were separated for 45 min at 180 V ...
-
bioRxiv - Neuroscience 2022Quote: ... 3.5 cm) containing 30 larvae and a plastic-covered stirrer (magnetic stir bar micro PTFE 6 mm x 3 mm; Fisher Scientific) were placed on a magnetic stir plate (Variomag Poly 15 stirrer plate ...
-
bioRxiv - Neuroscience 2023Quote: HEK-293T cells were seeded on 6-well culture plates at 3 x 106 cells/well and grown in Dulbecco modified Eagle medium (DMEM; Thermo Fisher Scientific ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... NM_002524.5) with a 3’ terminal 6 × His-tag was chemically synthesized and cloned into the pFastBac1 vector (Invitrogen, Carlsbad, California, USA). cDNA of NRASQ61R was cloned into the pLVSIN-EF1α-AcGFP-C1 vector (Takara Bio Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µL of primers (final concentration 200 nM) and 6 µL of Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). The amplification conditions included an initial incubation for 2 min at 50°C ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were subjected to 6 rounds of 10 sec sonication each at power 3 in a 550 Sonic Dismembrator (Fisher Scientific). Between each round of sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... differentiated OLs at 6 DIV (‘OL 3 days’) were transfected with plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: 1.3 million HEK293T cells were seeded in a 6 cm dish in 5 ml of DMEM [high glucose DMEM (Gibco, 12800), 3.7 g/L NaHCO3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by secondary staining for one hour at RT (1:250, Alexa-488, Invitrogen, A11008). Images were taken using a LSM 510 confocal microscope (Carl Zeiss ...
-
bioRxiv - Biochemistry 2020Quote: ... One aliquot was treated with DSG (disuccinimidyl glutarate) crosslinker (1 mM) (Thermo Scientific, Cat# 20593) and the other served as a DMSO only negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... 60 degrees for 1 min] x 40 cycles) on a Step-One Plus (Applied Biosystems) using Sybr Green (Bio-rad ...
-
bioRxiv - Microbiology 2023Quote: ... RNA quality was verified by 1% agarose electrophoresis and quantified using Nanodrop One (Thermo Scientific). As control ...
-
bioRxiv - Genomics 2024Quote: ... one third of the vegetative stage cells were resuspended in 1 ml TRIzol Reagent (Invitrogen) and stored at −20°C until further processing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one guide sequence (Table 1) was generated by following the MEGAscript®Kit (Invitrogen) protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were stained for one hour with phalloidin Alexa fluor 488 (1:300, ThermoFisher, A12379) or phalloidin Alexa fluor 568 (1:300 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Cell Biology 2024Quote: ... a premium microscope slide (Fisher-finest, 3″ × 1″ × 1 mm; Thermo Fisher Scientific, 12-544-1) or chambered coverglass (1 well ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...