Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 3' 3' Cyclic GAMP cGAMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μl of samples were transferred to a microwell plate (Nunc™ 3 84-Well Optical Bottom Plates # 242764, Thermo Scientific) and the time course of fluorescence-intensity (see Fig ...
-
bioRxiv - Immunology 2024Quote: High-throughput screening of antibodies was done using Expi293 cells grown in 3 mL plates in 24 deep-well plates (Thermo Fisher). Cultures were grown for four days ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Immunology 2024Quote: ... Anti-GPI antibody ELISA was conducted by coating ELISA plates (Invitrogen, Cat. No. 44-2404-21) with 50 μl of 10 μg/ml Glucose-6-Phosphate Isomerase (SIGMA ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... HACAT and KB 3-1 cells were seeded into white 1536-well plates using a Multidrop Combi peristaltic dispenser (ThermoFisher, Waltham, MA) at a density of 250 ...
-
bioRxiv - Bioengineering 2022Quote: ... pools of 10 couples (n=8) were maintained up to 1 month in 6 well plates (9.6 cm2) using 3 mL of M199 (GIBCO, 41150-020, UK), DMEM (GIBCO ...
-
bioRxiv - Cancer Biology 2023Quote: ... RPMI 8866 B lymphoblastoid cell line in a ratio 3:1 (3×106 PBMCs and 1×106 8866 cells per well in a 12 well-plate) in RPMI 1640 GlutaMax (Thermo Fisher Scientific) supplemented with penicillin (100 U/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... were plated into 12-well plate at a density of 3-4 × 105 cells in 1 mL per well in 1x DMEM (Gibco Cat# 11995065) plus 10% FBS (Gibco Cat# 16000044 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The plates were then washed thrice with 0.05% PBST and blocked with 3% BSA (Fisher Scientific) in PBS for 30 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Plates were then washed 3 times and incubated with 50 μl streptavidin-alkaline phosphatase (ThermoFisher, 434322) diluted 1:1000 in 0.3% BSA-PBS for 1 hour at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... SKOV-3 cells were seeded on 96-well Nunclon Sphera round bottom plates (Thermo Fisher Scientific) at a density of 2 x 103 cells/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Plant Biology 2020Quote: ... and biotinylated using the Biotin 3′ End DNA Labeling Kit (Thermo Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: Oligonucleotides were labelled using a 3’ biotin end-labelling kit (Thermo Scientific). Binding reactions were carried out at room temperature with 1µg of GBP2 in the presence of 50ng dIdC ...
-
bioRxiv - Immunology 2020Quote: ... A beta release of the Collibri 3’ mRNA Library Prep Kit (Invitrogen) was used to prepare libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was labelled using the 3’ end desthiobiotinylation RNA labelling kit (ThermoFisher), with 150ug/25nM RNA per reaction incubated at 16°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... kit in a QuantStudio™ 3 Reak-Time PCR Instrument (Applied Biosystems). The ΔΔCt method was used to analyze levels of transcripts and data were normalized to the levels of Gapdh or as indicated.
-
bioRxiv - Pathology 2022Quote: ... 2 and 3 were quantified using CyQUANT Proliferation Assay Kit (Invitrogen, C35011); For myofibroblast differentiation assay ...
-
bioRxiv - Molecular Biology 2022Quote: ... and labeled using the Pierce RNA 3′ End Desthiobiotinylation Kit (ThermoFisher Scientific). HOXC13-AS pulldown assay was performed using the Pierce Magnetic RNA-Protein Pull-Down Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The Silencer™ siRNA Labeling Kit with Cy™3 dye (Invitrogen) was used to label dsRNA following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... which were biotin-labeled using a GeneChip 3’ IVT express kit (Affymetrix). Microarray analysis was performed at TaKaRa-Bio using high-density oligonucleotide array (Human Genome U133 Plus 2.0 ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: Cross-linking experiments of Sgo11-415 and CPCISB10-280 were performed using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific) in the presence of N-hydroxysulfosuccinimide (NHS ...
-
bioRxiv - Microbiology 2019Quote: ... and then induced to differentiate by culturing for further 3 days in a 3:1 mixture of DMEM and Ham’s F12 media (Invitrogen, Palo Alto, CA) containing FCS (10%) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was lawned with goat anti-human IgG Fc (50 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was coupled directly to mAbs diluted to 10 µg/mL in 10 mM sodium acetate (pH 4.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg of plasmid and 3 μL of Lipofectamine 2000 (m/v = 1:3) were diluted in 0.1 mL of Opti-MEM (Gibco, 31985070, Gaithersburg, MD). After 5 min of incubation ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Flat bottom 96-well ELISA plates (Nunc MaxiSorp Plates, Thermo Fisher Scientific, Planegg, Germany) were coated with 50 ng/well recombinant 2019-nCoV (COVID-19 ...
-
bioRxiv - Microbiology 2021Quote: ... each well of a 96-well ELISA plates (Nunc-Immuno 96-well, Polysorp plates) was coated with 1 μg/ml NDO-LID (Natural Octyl Disaccharide-Leprosy IDRI Diagnostic ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the Mouse Monocyte Chemoattractant Protein-1/CCL2 (MCP-1) Uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...